Rna Extraction Cdna Synthesis And Real Time Pcr For...

RNA extraction, cDNA synthesis and real-time PCR for Smad3 gene Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript  ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 - AGGGCTTTGAGGCTGTCTACC-3 ) and reverse primer (5 - ACCCGATCCCTTTACTCCCA -3 ) (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5†²-GGTGAAGTTCGGAGTCAACGGA-3†²) and reverse primer (5†²-GAGGGATCTCGCTCCTGGAAGA-3†²) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA). Statistical analysis Statistical analysis was conducted as mean and standard deviation using Statistical Package for Social Sciences (SPSS), version 16.0 for Windows (SPSS, Chicago, IL).Show MoreRelatedEnvironmental Pollutants, Drug And Ionizing Radiation Causes Inflammation And Oxidative Stress1951 Words   |  8 PagesSmad proteins act as primary mediators of inflammatory and fibrotic response [4].Carnosine (ÃŽ ²-alanyl-L-histidine) is a dipeptide with anti-ischemic, anti-oxidant, membrane stabilizing, heavy metal chelating activities, and reduces matrix proteins synthesis such as fibronectin, collagen of podocytes and mesangial cells [5,6]. Material and methods This research was carried out in accordance to the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publications

The war which the world feared upon never happened Free Essays

The war which the world feared upon never happened, the Cold War. United States of America and the Soviets are preparing for this battle as who among these super powers will really dominate the world. As a means of preparation they are to dominate the seas, especially the under sea navigational fleet, the Submarines. We will write a custom essay sample on The war which the world feared upon never happened or any similar topic only for you Order Now American leaders as a means of preparing for battle put their trust and confidence in their submarine force. Empowered by their own power plants these nuclear submarines are to dominate the seas with unbelievable sophistication and with weapons of incredible destructive power. The idea of submarine came from the Germans who were the ones who pioneered in the creation of the vessel during World War II (Weir, 1998). The US Navy has envisioned that submarines of the future would go deeper and move much faster. Thus as the years passed, the nuclear submarine was created. Under the US military force, the main mission of the first known SSBNs or â€Å"Ship Submersible Ballistic Nuclear† was for the prevention of war to happen. They are to be deployed to strategic sites for them to guard and thus to prevent war   (Weir, 1998). Because of their relentless power, as the nuclear is used to propel them, they have the capability to submerge and circumnavigate the world with fewer expenses. They can submerge for number of days to avoid detection and can easily guard strategic sites as their main mission. They are considered as the guardians of a possible nuclear war. According to David Munns in his book, the greatest advantage so that submarines, armed with ballistic missiles, can release its relentless power is that they have to be close to the shore. This idea was the main basis for the development of the undersea military force of both United States and the Soviet Union. Throughout the 45-year Cold War both countries developed submarines, especially nuclear powered, to gain intelligence or for espionage, due to its stealth power, and to attack and destroy any possible enemy surface ships. Its powerful ballistic missiles have the ability to attack ground or land based targets. Both countries develop such powerful undersea fleet and were considered as the most potent nuclear threat for both of them. (Munns, 2004) The main idea was that to counter this powerful surface warships and nuclear propelled missile cruisers and aircraft carries they have to develop more powerful underground fleet (Munns, 2004). With the development of the nuclear power, the first ship that was ever built by the Americans that went to sea is the USS Nautilus. It went to sea on January of 1955. It is propelled by pressurized-water nuclear reactor plant. This firs submarine built by the Americans sets the new standard for submarines (Huchtausen, 2002). The Russians on the other hand, built their first submarine which went to sea on a much later date. The K-3 or also known as Leninsky Komosol, it is a part of the November class of attack submarines only went to sea only on 1958. This submarine was the first Soviet sub who have reached the North pole, only in 1962, which the United States first sub USS Nautilus have already done four years earlier. The November class submrines however had serious problems one example was the accident happened in 1968 of its K-27 due to a radioactive gas lead which killed 9 people (Huchthausen, 2002). The next Class of submarines that was built by the Americans was the Skipjack Class Submarines. Built in 1959, this attack submarine was the first to combine nuclear power which has extraordinary speed. This is more hydronamic which has a new teardrop hull design. All other US submarines that was created was based on this design. The known accident that happened for this class of submarine was on May 21, 1968 when the USS Skipjack Scorpion was lost in the sea and was nowhere to be found even due to extensive military search. All the 99 people aboard the submarine also lost their lives (Compton-Hall, 1999). The Soviet built the Hotel-class submarines on 1960. This is the first Soviet Nuclear subs which carries with it ballistic missiles. The design of the November Class is much similar to that of the November class, but with much larger compartment to accommodate the ballistic missiles (Compton-Hall, 1999). On the same year the Skipjack Class was created, the US Military built the USS George Washington Class. Built and deployed on 1959, this submarine was the first Nuclear Ballistic missile submarine which was created. The main idea for this ballistic missile submarines was that it would attack land-based targets with its nuclear weapons. They are to be deployed near shore targets so that their long range missiles can easily hit their targets. The Soviets then build the Victor Class submarines in 1967. Their design was to attack enemy submarines and to protect surface ships of the Soviets. The new teardrop hull enabled the Victor Class to attain higher speed. The Soviets however abandoned the construction of the second Victor submarine design after learning through spy information that the NATO forces could easily track them (Compton-Hall, 1999). Due to this, the Soviets created the Victor III submarine. The Americans on 1961 built the Thresher Class attack submarines. This submarine is much stronger, much faster, and can dive much deeper. It is also designed to be quieter than the Skipjack Class, the materials used in this class have more streaming improvements. The name was however changed from Thresher Class to Permit Class when the submarine Thresher sank in New England in 1963 killing all 129 crew (Huchtausen, 2002). In 1967, the Soviets created the Yankee Class submarines. This is the first Submarine that has the same firepower as that of the US submarines. This is much quieter than the Hotel Class due to a new hull shape, a new propeller design, and exterior sound-deadening coatings which is much harder to track. Several modifications were also made on this class, with its big design it was enabled to carry miniature submarines. On 1976, the Americans built and deployed the Los Angeles class. This class had 62 vessels built and is considered as the world’s largest nuclear-propelled submarine. This class was designed to primarily protect carriers and other enemy submarine. The purpose of this submarine was the same as that of the Soviet’s Victor Class. This submarine however was much more powerful than the Victor class because of its capability to do other special missions such as deployment of Special Forces on the ground and attacking larger targets. The Los Angeles class was also improved for better ice operations on the North and South Pole (Compton-Hall, 1999). The next class built by the Soviet and one of the last Class is the Typhoon class submarine. During its time, in 1981, it was considered as the world’s largest attack submarine. This improved design which is much quieter compared to its size. This submarine is also more maneuverable even if it is huge. The design of this submarine is much more complicated due to the existence of two pressure hulls which is parallel with each other and a third hull which is on top of them. This design increases its width and had simplified internal arrangements. Being part of a cooperative arms reduction program of the former Soviet states, six of the Typhoon class was dismantled in 2003 (Compton-Hall, 1999). The Ohio-class submarine is the last among the long line of designs of the ballistic-missile submarine fleet of US.   It replaced the old 1960s version and was larger and more capable than its precedents.   These subs can carry more and longer-range weapons, operate more quietly, and dive deeper (Compton-Hall, 1999).   Russia, on the other hand, designed the contemporary of Ohio, the Oscar submarines.   These are Russia’s largest and most advanced and are still active submarines.   Designed to attack U.S. aircraft carrier battle groups, it carries three times as many antiship cruise missiles than its predecessors (Compton-Hall, 1999). Norman Polmar and K.J. Moore, were two naval officials under the US Armed Forces who were interviewed by Munns in his book. They said that â€Å"the United States and the Soviet Union put to sea a combined total of 936 submarines, of which 401 were nuclear propelled,† during the whole Cold war from 1945-1991 (Munns, 2004). The Soviet Union was the one who is aggressive in the development of submarines. This development still continues until after the 1970’s where research and effort to make the vessels more powerful were developed. From the mid-1940s until early 1990s, Cold War was a period of conflict and competition between two superpowers, the United States and the Soviet Union.   It was also a period of great technological advancements in the military with no less than the development of nuclear submarines.   Faster, quieter and deadlier weapons were developed. It was also this same period which placed the entire world on edge. And knowing the potentials of these weapons, the war that never happened also brought unparalleled relief to mankind. WORKS CITED: Compton-Hall, Richard. The Submarine Pioneers. Sutton Publishing, 1999. Huchthausen, Peter. K-19: The Widowmaker—The Secret Story of the Soviet Nuclear Submarine. National Geographic Books, 2002. Munns, David W. Sea Power. May 2004. Retrieved at http://findarticles.com/p/articles/mi_qa3738/is_200405/ai_n9345820 Polmar, Norman and Moore,K.J. COLD WAR SUBMARINES: The Design and Construction of U.S. and Soviet Submarines.   Dulles, Va.: Brassey’s, March 2004. 336 pp. Weir, Gary E. Deep Ocean, Cold War. Washington: Brassey’s, 1998. Evolution of Subs: U.S. and Soviet Submarine Milestones of the Cold War. National Geographic. http://www.nationalgeographic.com/k19/evolution_main.html http://www.navy.mil/navydata/cno/n87/usw/issue_7/deepocean.htm How to cite The war which the world feared upon never happened, Essay examples

Boy at the Window free essay sample

The author explains in our textbook that it was written, â€Å"After seeing how distressed his five-year old son was about a snowman they had built. † (cited in Clugston, 2010) The message and theme is about how a little boy becomes sad after building a snowman and seeing him outside all alone and sad. Wilbur uses different literary elements to draw strong emotions and express fear of losing a friend/loved one. The author shows us two different points of view in this poem, first with the young boy and then with the cold snowman. In the first few lines the reader thinks that the young boy is crying about the snowman and how petrified he may be. The boy sees the snowman, while looking out his window he is all alone and by himself. Then the wind is heard from the boy picking up and starts feeling what the snowman might be feeling. There is so much compassion and heartbreak that the boy feels for the snowman at this time. The use of personification is shown while Wilbur states, â€Å"the pale faced figure with bituemen eyes return him a God-forsaken stare. † (cited in Clugston, 2010, â€Å"Boy at the Window†, 6) I believe the author Wilbur was creating a unique situation; he uses great personifications for the snowman. Personification is a figure of speech formed when qualities normally associated with a person are attributed to abstract things or inanimate objects. † (cited in Clugston, 2010) The snowman is the conent, he did not want to go inside the house yet as he looked at the young boys cry. Since the snowman would melt if he went into the heated room, he decides to stay outside even though the boy was crying. However, the snowman’s heart is moved from the boys cry, but cannot live in his world. â€Å"The man of snow is, nonetheless, content, having no wish to go inside and di e. Still, he is moved to see the youngster cry. † (cited in Clugston, 2010, â€Å"Boy at the Window† 9) The poem creates a feeling of fear and the unknown of what will happen in the afterlife. It is very sad to see a young child cry since they do not understand yet and will have to go through these hard life situations to really understand it. In the poem Wilbur made the character of the snowman human which created human characteristics to allow the reader get involved. Human nature brings out so many emotions with us and makes us feel compassion for others. An allusion is a reference a writer makes to a recognized literary work, a person, a historic event, or an artistic achievement to clarify the meaning of an action or a detail in a story, poem, or drama. † (cited in Clugston, 2010) The allusion is shown in Wilbur’s poem, â€Å"Return to him such a God-forsaken stare. As outcast Adam gave to paradise. † (cited in Clugston, 2010, â€Å"Boy at the Wind ow†, 7amp;8) This is a religious and biblical reference referring to Adam and Eve. Adam’s expulsion from the Garden of Eden represents believers of the scripture. I believe that he was making a statement of fear of not able to help the boy from fear and evil. The language is very strong in its meanings in this poem and makes you feel it with word choices. The temptations of entering their worlds would bring great harm and there was nothing they could do or say to be with each other. There is also a simile used in the line of Adam and the Garden of Eden allusion, the snowman is starring at the poor boy and cannot grasp him, just like Adam was looking at the paradise that was no longer his but just steps away. Irony is also characterized in this poem, the boy expects that the snowman will always be there as a friend. However, that was not the case, the snowman melted and died in the boys mind. The imagination language was very interesting and was full of surprise. The form of this poem was free verse, â€Å"This shown by its irregular rhythm and the lines vary in length and lack in rhyme,† it really made the reader follow the poem easily and made you stay interested in it. cited in Clugston, 2010) However, the author makes you feel that he is loved by the family by warmth inside, â€Å"For the child at the bright pane surrounded by such warmth, such light, such love, and so much fear. † (cited in Clugston, 2010, â€Å"Boy at the Window† 15) This makes you feel that the boy has so much fear of death, but still has loved ones to pick him back up. I feel that I could relate to this feeling since I have made so many snowmen in my childhood and lost them all. I can think ba ck and reminisce on how bad I felt when I saw my new friend disappear. Losing a loved one can be hard; I can relate this also to a child losing a pet, there are no words to even describe how painful it is. I lost a pet as a child and it tour my heart out since my pet would do anything just to stay with me, even if it meant suffering to no end. In life you have to experience hardship and bad situations, it is a learning curve and teaches you about life and death. Poems are so important in our society; they help to get feelings out and express real life situations in a poetic rhythm way. We face so many hard choices and have to let them be interpreted, â€Å"From an economic and cultural sphere increasingly dominated by finance capitol and advertising-gives it a chance to play a vital cultural role in an era of pressing ecological and ecological and economic crisis. † (Roberts, 2010) The use of the literary elements in Wilbur’s poem affects my response since he uses point of view from both the characters. He used his real life experiences to let the readers connect with his own feeling and this makes it more real. By using literary elements, it pulls out what message he is trying to get across in his poem.

The poem Ithaca Essay Example

The poem Ithaca Paper One of the most important messages expressed in the poem is that the Journey is the important part, therefore it does not matter if the goal is achieved but it matters that something is learnt on the journey to achieve it. One of the joys mentioned in the poem is to visit many Egyptian cities, to gather stores of knowledge from the learned. In the ancient world, Egypt was a center of learning, especially its capital city, Alexandria, which was one of the largest cities in the world and contained the largest library. This is a form of imagery that is used to show that when new places are visited, or new experiences are completed a persons knowledge will always increase. Have Ithaca always in your mind. Your arrival there is what you are destined for. Any traveler of the journey of life, must always keep Ithaca in mind, because it is his or her final destination, their ultimate aim. Without it there would be a lack motivation, which would lead to a minimum amount of goals being completed which means when Ithaca is reached a person will look back at their journey and be regretful. We will write a custom essay sample on The poem Ithaca specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on The poem Ithaca specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on The poem Ithaca specifically for you FOR ONLY $16.38 $13.9/page Hire Writer The journey to Ithaca should not be hurried, and it is better that it last many years, so that the traveler is old by the time he reaches the final destination and has gained many things from their journey. This is due to the fact that throughout that extra time an Individual can achieve more goals have more adventures and gain more knowledge. However an Individual should not be expecting Ithaca to give you wealth. Ithaca gave you a splendid journey. Without her you would not have set out. She hasnt anything else to give you. This is because throughout the journey to reach Ithaca an individual should have achieved everything that they wanted to so that by the time they reach the end of their journey, or life, there will be nothing left for them to regret and they will be perfectly contend with their lives and what they have achieved. And if you find her poor, Ithaca hasnt deceived you. , because Ithaca has already gifted you, by being your goal, with so many thing and experiences that there will be nothing that Ithaca can give you due to the fact you will already have all you wanted. The Author believes that for a person to have a truly accomplished life and have no regret they most have goals and aims, with their final aim being Ithaca. Individuals should aim to experience the most out of their lives, and should realize that small things compared to big things in life can be just important. Throughout the journey of life there will be challenges and problems that will get in the way of an individual achieving their goals, but they should not let them get in their way of their final aim but count them as another step to accomplish it. Even if all goals are not completed as planned it does not matter for the journey to Ithaca is the important part, due to the fact that once the individual reaches Ithaca they will have gained knowledge and experience They should also have no regret. This is the gift Ithaca gives you. So wise you have become, of such experience, that already youll have understood what these Ithacas mean

Overview of Viking Trading and Exchange Networks

Overview of Viking Trading and Exchange Networks The Viking trade network included trading relationships into Europe, Charlemagnes Holy Roman Empire, into Asia, and the Islamic Abbasid empire. This is evidenced by the identification of items such as coins from North Africa recovered from a site in central Sweden and Scandinavian brooches from sites east of the Ural Mountains. Trade was a vital feature of the Norse Atlantic communities throughout their history and a way for the colonies to support their use of landnam, a sometime unreliable farming technique for environments the Norse didnt quite understand. Documentary evidence indicates that there were several groups of specific people who traveled between the Viking trading centers and other centers throughout Europe, as envoys, merchants or missionaries. Some travelers, such as the Carolingian missionary bishop Anskar (801-865) left extensive reports of their travels, giving us great insight to traders and their clients. Viking Trade Commodities The Norse traded commodities included slaves, but also coins, ceramics, and materials from specialized crafts such as copper-alloy casting and glass-working (beads and vessels both). The access to some commodities could make or break a colony: Greenlands Norse relied on trade in walrus and narwhal ivory and polar bear skins to support their ultimately failing farming strategies. Metallurgical analysis at Hrisbru in Iceland indicates that the elite Norse traded in bronze objects and raw material from the tin-rich regions in Britain. Significant trade in dried fish emerged near the end of the 10th century AD in Norway. There, cod played a significant role in Viking trade, when commercial fishing and sophisticated drying techniques allowed them to expand the market throughout Europe. Trade Centers In the Viking homeland, major trading centers included Ribe, Kaupang, Birka, Ahus, Truso, Grop Stromkendorf, and Hedeby. Goods were brought to these centers and then dispersed into the Viking society. Many of these site assemblages include an abundance of a soft yellow earthenware called Badorf-ware, produced in the Rhineland; Sindbà ¦k has argued that these items, rarely found on non-trading communities, were used as containers to bring goods to places, rather than as trade items. In 2013, Grupe et al. conducted stable isotope analysis of skeletal material at the Viking trade center of Haithabu (later Schleswig) in Denmark. They found that the diet of the individuals expressed in the human bones reflected the relative significance of trade over time. Members of the earlier community showed a predominance of freshwater fish (cod imported from the North Atlantic) in their diet, while later residents shifted to a diet of terrestrial domestic animals (local farming). Norse-Inuit Trade Theres some evidence in the Viking Sagas that trade played a role in the North American contact between the Norse and the Inuit occupants. Also, Norse symbolic and utilitarian objects are found at Inuit sites and similar Inuit objects in Norse sites. There are fewer Inuit objects in Norse sites, a fact which may be because the trade goods were organic, or that the Norse exported some Inuit prestige items into the wider European trade network. Evidence at the site of Sandhavn in Greenland seems to suggest that the quite rare co-existence of Inuit and Norse there was a result of the opportunity to trade with one another. Ancient DNA evidence from the Farm Beneath the Sand (GUS) site, also in Greenland, however, finds no support for the trade of bison robes, posited earlier from morphological examination. Viking and Islamic Trade Connections In a 1989 study of formal weights discovered at the Viking site of Paviken in Gotland near Vastergarn, Sweden, Erik Sperber reported three main types of trading weights in use: Ball-shaped weights of ironclad with a layer of bronze or solid bronze; these vary between 4 and 200 gmCubo-octaedric weights of lead bronze, tin bronze or brass; up to 4.2 gramsLeaden weights of different shapes and sizes Sperber believes at least some of these weights conform to the Islamic system of the Ummayyad dynasty leader Abd al Malik. The system, established in 696/697, is based on the dirhem of 2.83 grams and the mitqa of 2.245 grams. Given the breadth of Viking trade, it is likely that the Vikings and their partners may have utilized several trade systems. Sources: This glossary entry is a part of the About.com Guide to the Viking Age and part of the Dictionary of Archaeology.Barrett J, Johnstone C, Harland J, Van Neer W, Ervynck A, Makowiecki D, Heinrich D, Hufthammer AK, Bà ¸dker Enghoff I, Amundsen C et al. 2008. Detecting the medieval cod trade: a new method and first results. Journal of Archaeological Science 35(4):850-861.Dugmore AJ, McGovern TH, Và ©steinsson O, Arneborg J, Streeter R, and Keller C. 2012. Cultural adaptation, compounding vulnerabilities and conjunctures in Norse Greenland. Proceedings of the National Academy of Sciences 109(10):3658-3663Golding KA, Simpson IA, Schofield JE, and Edwards KJ. 2011. Norse-Inuit interaction and landscape change in southern Greenland? A geochronological, Pedological, and Palynological investigation. Geoarchaeology 26(3):315-345.Grupe G, von Carnap-Bornheim C, and Becker C. 2013. Rise and Fall of a Medieval Trade Centre: Economic Change from Viking Haithabu to Medieval Schleswig Revealed by S table Isotope Analysis. European Journal of Archaeology 16(1):137-166. Sindbà ¦k SM. 2007. Networks and nodal points: the emergence of towns in early Viking Age Scandinavia. Antiquity 81:119-132.Sindbà ¦k SM. 2007. The Small World of the Vikings: Networks in Early Medieval Communication and Exchange. Norwegian Archaeological Review 40(1):59-74.Sinding M-HS, Arneborg J, Nyegaard G, and Gilbert MTP. 2015. Ancient DNA unravels the truth behind the controversial GUS Greenlandic Norse fur samples: the bison was a horse, and the muskox and bears were goats. Journal of Archaeological Science 53:297-303.Sperber E. 1989. The weights found at the Viking Age site of Paviken, a metrological study. Fornvannem 84:129-134.Wrmlnder SKTS, Zori D, Byock J, and Scott DA. 2010. Metallurgical findings from a Viking Age chieftain’s farm in Iceland. Journal of Archaeological Science 37(9):2284-2290.

Project management review Essay Example | Topics and Well Written Essays - 4000 words

Project management review - Essay Example Once the system has been built to last, it is likely to contribute significantly to the operations of the central government in tracking large projects. However, a holistic approach needs to be taken in order for this project to be a resounding success. The phases outlined above need to be carefully taken into account. It can also be seen that project managers should possess various skills that can enable them to execute different project. These people should have effective communication skills as well as the ability to solve problems in order to succeed in carrying out this project. Table of contents 1.0 Introduction 3 1.1 Task A: Project definition 5 1.2 Project life cycle 5 1.3 Project scope, aims and objectives 6 2.0 Task B: approach to project management 8 2.1 Good approach versus bad approach to project management 8 2.1.1 Project definition 8 2.1.2 Agreement 9 2.1.3 Support 9 2.1.4 Communication 9 2.1.5 Measures to control risk 10 2.2 Project processes 10 2.3 Initiation 10 2.4 Planning 11 2.5 Execution and controlling 12 2.6 Monitoring and close out 13 3.0 Task C: Definition of control system 14 3.1 Effectiveness of the control system 15 3.2 How risk is handled 16 4.0 Task D: Qualities of an effective project manager 17 References 19 1.0 Introduction In order to understand the concept of project management, it is imperative to begin by defining the meaning of project. Basically, â€Å"a project is a special kind of activity and it involves something that is both unique and important and thereby requires unusual attention. It can also be noted that it has boundaries and has a beginning and an end,† (Flemming 2003, p.3). Thus, for any project to achieve its goals, it can be observed that project management is essential and it should be implemented in every stage of the project. It can be observed that there are various activities that are involved in the process of project management. According to Fox (2008), project management is a combination of st eps and techniques for keeping the goals and objectives, budget and schedule in order so as to achieve the desired outcome. A lot of project management tools are used in order to manage the project effectively so that the set goals and objectives can be achieved. The success of a given project mainly depends on the manager’s capability to control the different phases of the project such that all the efforts of the people involved are directed towards the achievement of the desired goals. All activities need to be properly managed so that they can be successfully implemented in the project. A project is characterised by the following factors: initiation, planning, execution as well as monitoring and closing out. These factors are very important in the execution of any given project and they determine its success or failure in most cases. Each phase in a project needs to be properly controlled such that the chances of achieving the desired goals are increased. The other advanta ge of controlling each stage is that necessary adjustments can be made along the way so that the objectives of the project are met. Effective project management entails that proper measures are put in place in order to deal with all the unprecedented changes that may be encountered during the course of the project. Project management also entails that all activities are controlled so that they remain within the set budget work the

Real World Negotiation Paper Assignment Example | Topics and Well Written Essays - 1500 words

Real World Negotiation Paper - Assignment Example Additionally, the increase would also see my employer acquiring maximum and satisfying service from me. Informed by the fact that successful negotiation is mainly realized through proper preparations, possess effective communication skills, being able to control emotions and having greatclossing the deal skills, I embarked on the quest for having a salary increase. As part of my preparation to face her and negotiate for my salary increment, I prepared myself in various ways as I have discussed below: I started by preparing a logical argument and evidence that could support and make my claim logical. Informed by the fact that activities key during the preparation process include developing position of strength, and establishing a foundation for success and developing confidence, I chose to start my preparation by coming up with a very strong argument as to why I felt the urge to approach my employer and demand for salary increase and why I stood a chance to see my salary being increas ed without much objection. I went on to compose evidence that will support all my arguments although in order to make my demand reasonable and realistic. I also considered my argument to be the demand for the increase to be because of rise in the cost of living and the supporting evidence was that other employers within the region had seen their salary being increased, inflation had resulted to the fall of value of money which in turned had reduced my purchasing power and therefore the amount I was being paid did too little to satisfy all my needs, there was also a general increase in price of commodities which demanded for more money than I was earning before and finally that it was also meant to be a sign of appreciation to for the good job the I had been doing for my employee for so long. I also went on to consider the amount of salary increase that I expect. I went on with my preparation process of computing and coming up with an amount of money that I was to propose as my incre ment. I choose to come up with the maximum amount and reasonable amount of my salary increase that I expected from my employer and also the minimum amount that I was to expect in the course of the negotiation process. As part of my preparation I also choose to come with a formal letter and send it early enough to notify and prepare my employee over the setting of the negotiation date and this was also meant to prepare my employer psychologically over considering my pay rise. Since my employer was never around and were never met so easily, I also considered my grooming as part of my preparation. This was because my personal appearance and outlook was also to play an important at either building my reputation or destroying it. I also knew that smartness played a critical role towards boosting my confidence. During the negation day, all went well and as planned, the negotiation date was set in advance and in consideration to the schedule of both sides not interfering with the any of ou r activities. On the negotiation d