Rna Extraction Cdna Synthesis And Real Time Pcr For...

RNA extraction, cDNA synthesis and real-time PCR for Smad3 gene Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript  ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 - AGGGCTTTGAGGCTGTCTACC-3 ) and reverse primer (5 - ACCCGATCCCTTTACTCCCA -3 ) (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5†²-GGTGAAGTTCGGAGTCAACGGA-3†²) and reverse primer (5†²-GAGGGATCTCGCTCCTGGAAGA-3†²) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA). Statistical analysis Statistical analysis was conducted as mean and standard deviation using Statistical Package for Social Sciences (SPSS), version 16.0 for Windows (SPSS, Chicago, IL).Show MoreRelatedEnvironmental Pollutants, Drug And Ionizing Radiation Causes Inflammation And Oxidative Stress1951 Words   |  8 PagesSmad proteins act as primary mediators of inflammatory and fibrotic response [4].Carnosine (ÃŽ ²-alanyl-L-histidine) is a dipeptide with anti-ischemic, anti-oxidant, membrane stabilizing, heavy metal chelating activities, and reduces matrix proteins synthesis such as fibronectin, collagen of podocytes and mesangial cells [5,6]. Material and methods This research was carried out in accordance to the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publications