Compare Lamb to the Slaughter and The Speckled Band Essay

Murder mysteries - Compare Lamb to the Slaughter and The Speckled Band. Murder mysteries all have a similar plot consisting of a body, a motive, a weapon, a suspect, an alibi, and detectives. Viewers and readers expect this in the text, Lamb to the Slaughter and The Speckled Band are no exception. The structures of the two stories are very different, with The Speckled Band story unfolding in chronological order, finding out the murderer right at the end, however in the Lamb to the Slaughter, the murderer is known at the beginning of the story. The two stories are seen from two different points of view, first-person narrator in The Speckled Band as Dr Watson character within the story and therefore limited in understanding†¦show more content†¦Also in The Speckled Band, Dr Roylott, is the evil, plotting, devious, fictional murderer; this character was portrayed in most murder mysteries stories written in the late 19 century. The Speckled Band was written in 1892. In the Lamb to the Slaughter we had no idea who the murderer and victim were going to be until the murder had been committed, in fact you might of thought the roles would have been reversed once reading the first few pages. The detectives in the story are portrayed as acting as typical modern police detectives, they eat the evidence! The detectives appear so stupid and useless compared to the marvellous and calculating Sherlock Holmes. The points of high tension are different in the two stories. In The Speckled Band the main point of high tension is right at the end when they find out who the murderer is and when the snake comes at Holmes Holmes sprang from the bed, struck a match, and lashed furiously with his cane at the bell-pull. Other points of tension were Helen Stoner talking to Holmes, Frightened eyes like those of some hunted animal, the night of the murder, A wild wind. The wind was howling outside suddenly there burst forth the wild scream of a woman, and the sisters hot words, She suddenly shrieked out in a voice which I shall never forget, O, my God! Helen! It was the band! The Speckled band! In the Lamb to the Slaughter the point of high tension is whether the detectives wouldShow MoreRelated Compare and Contrast Lamb to the Slaughter and The Speckled Band1392 Words   |  6 PagesCompare and Contrast Lamb to the Slaughter and The Speckled Band ‘Lamb to the Slaughter’ and ‘The Speckled Band’ are both written is separate eras and cultures, and these differences are reflected in the way the authors use language, structure and moral techniques in their stories. How ever, there are some similarities in these stories as both are of the thriller genre. The story ‘Lamb to the Slaughter’ is about a husband and a wife whose relationship comes to a sudden halt. The sweetRead MoreMurder Mysteries Essay2434 Words   |  10 PagesHow Far Are The Speckled Band And Lamb To The Slaughter Typical Of Murder Mysteries? How Are The Stories The Same And How Are They Different? Compare The Ways In Which The Stories Are Told Murder mystery usually means where there is a murder involving money, love or revenge. The victims friend or a family member goes to a detective and tells them what they know about the murder and the suspects and where they were, and what they were doing at that time. There are a lot of famous detectivesRead MoreAtmosphere and Tension in The Speckled Band by Air Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl2251 Words   |  10 PagesAtmosphere and Tension in The Speckled Band by Air Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl Both the stories I am analysing are murder mysteries and they are set in very different time periods. Summary of stories lamb to the slaughter The lamb to the slaughter was a murder mystery story based on a troubled couple. Mary Malone is a keen housewife who is deeply in love with her husband and will do nearly anything to please him. Her husband isRead MoreThe Speckled Band by Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl2642 Words   |  11 Pageshistorical context of each text reflected in The Speckled Ban by Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl. In this essay, I intend to compare and contrast the two short stories The Speckled Band by Sir Arthur Conan-Doyle, and Lamb to the Slaughter by Roald Dahl, picking out techniques used which make it exactly, or exactly the opposite of a typical detective story/murder mystery. Both The Speckled Band and Lamb to the Slaughter have ingredients for a detective story

Rna Extraction Cdna Synthesis And Real Time Pcr For...

RNA extraction, cDNA synthesis and real-time PCR for Smad3 gene Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript  ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 - AGGGCTTTGAGGCTGTCTACC-3 ) and reverse primer (5 - ACCCGATCCCTTTACTCCCA -3 ) (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5†²-GGTGAAGTTCGGAGTCAACGGA-3†²) and reverse primer (5†²-GAGGGATCTCGCTCCTGGAAGA-3†²) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA). Statistical analysis Statistical analysis was conducted as mean and standard deviation using Statistical Package for Social Sciences (SPSS), version 16.0 for Windows (SPSS, Chicago, IL).Show MoreRelatedEnvironmental Pollutants, Drug And Ionizing Radiation Causes Inflammation And Oxidative Stress1951 Words   |  8 PagesSmad proteins act as primary mediators of inflammatory and fibrotic response [4].Carnosine (ÃŽ ²-alanyl-L-histidine) is a dipeptide with anti-ischemic, anti-oxidant, membrane stabilizing, heavy metal chelating activities, and reduces matrix proteins synthesis such as fibronectin, collagen of podocytes and mesangial cells [5,6]. Material and methods This research was carried out in accordance to the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publications

The war which the world feared upon never happened Free Essays

The war which the world feared upon never happened, the Cold War. United States of America and the Soviets are preparing for this battle as who among these super powers will really dominate the world. As a means of preparation they are to dominate the seas, especially the under sea navigational fleet, the Submarines. We will write a custom essay sample on The war which the world feared upon never happened or any similar topic only for you Order Now American leaders as a means of preparing for battle put their trust and confidence in their submarine force. Empowered by their own power plants these nuclear submarines are to dominate the seas with unbelievable sophistication and with weapons of incredible destructive power. The idea of submarine came from the Germans who were the ones who pioneered in the creation of the vessel during World War II (Weir, 1998). The US Navy has envisioned that submarines of the future would go deeper and move much faster. Thus as the years passed, the nuclear submarine was created. Under the US military force, the main mission of the first known SSBNs or â€Å"Ship Submersible Ballistic Nuclear† was for the prevention of war to happen. They are to be deployed to strategic sites for them to guard and thus to prevent war   (Weir, 1998). Because of their relentless power, as the nuclear is used to propel them, they have the capability to submerge and circumnavigate the world with fewer expenses. They can submerge for number of days to avoid detection and can easily guard strategic sites as their main mission. They are considered as the guardians of a possible nuclear war. According to David Munns in his book, the greatest advantage so that submarines, armed with ballistic missiles, can release its relentless power is that they have to be close to the shore. This idea was the main basis for the development of the undersea military force of both United States and the Soviet Union. Throughout the 45-year Cold War both countries developed submarines, especially nuclear powered, to gain intelligence or for espionage, due to its stealth power, and to attack and destroy any possible enemy surface ships. Its powerful ballistic missiles have the ability to attack ground or land based targets. Both countries develop such powerful undersea fleet and were considered as the most potent nuclear threat for both of them. (Munns, 2004) The main idea was that to counter this powerful surface warships and nuclear propelled missile cruisers and aircraft carries they have to develop more powerful underground fleet (Munns, 2004). With the development of the nuclear power, the first ship that was ever built by the Americans that went to sea is the USS Nautilus. It went to sea on January of 1955. It is propelled by pressurized-water nuclear reactor plant. This firs submarine built by the Americans sets the new standard for submarines (Huchtausen, 2002). The Russians on the other hand, built their first submarine which went to sea on a much later date. The K-3 or also known as Leninsky Komosol, it is a part of the November class of attack submarines only went to sea only on 1958. This submarine was the first Soviet sub who have reached the North pole, only in 1962, which the United States first sub USS Nautilus have already done four years earlier. The November class submrines however had serious problems one example was the accident happened in 1968 of its K-27 due to a radioactive gas lead which killed 9 people (Huchthausen, 2002). The next Class of submarines that was built by the Americans was the Skipjack Class Submarines. Built in 1959, this attack submarine was the first to combine nuclear power which has extraordinary speed. This is more hydronamic which has a new teardrop hull design. All other US submarines that was created was based on this design. The known accident that happened for this class of submarine was on May 21, 1968 when the USS Skipjack Scorpion was lost in the sea and was nowhere to be found even due to extensive military search. All the 99 people aboard the submarine also lost their lives (Compton-Hall, 1999). The Soviet built the Hotel-class submarines on 1960. This is the first Soviet Nuclear subs which carries with it ballistic missiles. The design of the November Class is much similar to that of the November class, but with much larger compartment to accommodate the ballistic missiles (Compton-Hall, 1999). On the same year the Skipjack Class was created, the US Military built the USS George Washington Class. Built and deployed on 1959, this submarine was the first Nuclear Ballistic missile submarine which was created. The main idea for this ballistic missile submarines was that it would attack land-based targets with its nuclear weapons. They are to be deployed near shore targets so that their long range missiles can easily hit their targets. The Soviets then build the Victor Class submarines in 1967. Their design was to attack enemy submarines and to protect surface ships of the Soviets. The new teardrop hull enabled the Victor Class to attain higher speed. The Soviets however abandoned the construction of the second Victor submarine design after learning through spy information that the NATO forces could easily track them (Compton-Hall, 1999). Due to this, the Soviets created the Victor III submarine. The Americans on 1961 built the Thresher Class attack submarines. This submarine is much stronger, much faster, and can dive much deeper. It is also designed to be quieter than the Skipjack Class, the materials used in this class have more streaming improvements. The name was however changed from Thresher Class to Permit Class when the submarine Thresher sank in New England in 1963 killing all 129 crew (Huchtausen, 2002). In 1967, the Soviets created the Yankee Class submarines. This is the first Submarine that has the same firepower as that of the US submarines. This is much quieter than the Hotel Class due to a new hull shape, a new propeller design, and exterior sound-deadening coatings which is much harder to track. Several modifications were also made on this class, with its big design it was enabled to carry miniature submarines. On 1976, the Americans built and deployed the Los Angeles class. This class had 62 vessels built and is considered as the world’s largest nuclear-propelled submarine. This class was designed to primarily protect carriers and other enemy submarine. The purpose of this submarine was the same as that of the Soviet’s Victor Class. This submarine however was much more powerful than the Victor class because of its capability to do other special missions such as deployment of Special Forces on the ground and attacking larger targets. The Los Angeles class was also improved for better ice operations on the North and South Pole (Compton-Hall, 1999). The next class built by the Soviet and one of the last Class is the Typhoon class submarine. During its time, in 1981, it was considered as the world’s largest attack submarine. This improved design which is much quieter compared to its size. This submarine is also more maneuverable even if it is huge. The design of this submarine is much more complicated due to the existence of two pressure hulls which is parallel with each other and a third hull which is on top of them. This design increases its width and had simplified internal arrangements. Being part of a cooperative arms reduction program of the former Soviet states, six of the Typhoon class was dismantled in 2003 (Compton-Hall, 1999). The Ohio-class submarine is the last among the long line of designs of the ballistic-missile submarine fleet of US.   It replaced the old 1960s version and was larger and more capable than its precedents.   These subs can carry more and longer-range weapons, operate more quietly, and dive deeper (Compton-Hall, 1999).   Russia, on the other hand, designed the contemporary of Ohio, the Oscar submarines.   These are Russia’s largest and most advanced and are still active submarines.   Designed to attack U.S. aircraft carrier battle groups, it carries three times as many antiship cruise missiles than its predecessors (Compton-Hall, 1999). Norman Polmar and K.J. Moore, were two naval officials under the US Armed Forces who were interviewed by Munns in his book. They said that â€Å"the United States and the Soviet Union put to sea a combined total of 936 submarines, of which 401 were nuclear propelled,† during the whole Cold war from 1945-1991 (Munns, 2004). The Soviet Union was the one who is aggressive in the development of submarines. This development still continues until after the 1970’s where research and effort to make the vessels more powerful were developed. From the mid-1940s until early 1990s, Cold War was a period of conflict and competition between two superpowers, the United States and the Soviet Union.   It was also a period of great technological advancements in the military with no less than the development of nuclear submarines.   Faster, quieter and deadlier weapons were developed. It was also this same period which placed the entire world on edge. And knowing the potentials of these weapons, the war that never happened also brought unparalleled relief to mankind. WORKS CITED: Compton-Hall, Richard. The Submarine Pioneers. Sutton Publishing, 1999. Huchthausen, Peter. K-19: The Widowmaker—The Secret Story of the Soviet Nuclear Submarine. National Geographic Books, 2002. Munns, David W. Sea Power. May 2004. Retrieved at http://findarticles.com/p/articles/mi_qa3738/is_200405/ai_n9345820 Polmar, Norman and Moore,K.J. COLD WAR SUBMARINES: The Design and Construction of U.S. and Soviet Submarines.   Dulles, Va.: Brassey’s, March 2004. 336 pp. Weir, Gary E. Deep Ocean, Cold War. Washington: Brassey’s, 1998. Evolution of Subs: U.S. and Soviet Submarine Milestones of the Cold War. National Geographic. http://www.nationalgeographic.com/k19/evolution_main.html http://www.navy.mil/navydata/cno/n87/usw/issue_7/deepocean.htm How to cite The war which the world feared upon never happened, Essay examples

Boy at the Window free essay sample

The author explains in our textbook that it was written, â€Å"After seeing how distressed his five-year old son was about a snowman they had built. † (cited in Clugston, 2010) The message and theme is about how a little boy becomes sad after building a snowman and seeing him outside all alone and sad. Wilbur uses different literary elements to draw strong emotions and express fear of losing a friend/loved one. The author shows us two different points of view in this poem, first with the young boy and then with the cold snowman. In the first few lines the reader thinks that the young boy is crying about the snowman and how petrified he may be. The boy sees the snowman, while looking out his window he is all alone and by himself. Then the wind is heard from the boy picking up and starts feeling what the snowman might be feeling. There is so much compassion and heartbreak that the boy feels for the snowman at this time. The use of personification is shown while Wilbur states, â€Å"the pale faced figure with bituemen eyes return him a God-forsaken stare. † (cited in Clugston, 2010, â€Å"Boy at the Window†, 6) I believe the author Wilbur was creating a unique situation; he uses great personifications for the snowman. Personification is a figure of speech formed when qualities normally associated with a person are attributed to abstract things or inanimate objects. † (cited in Clugston, 2010) The snowman is the conent, he did not want to go inside the house yet as he looked at the young boys cry. Since the snowman would melt if he went into the heated room, he decides to stay outside even though the boy was crying. However, the snowman’s heart is moved from the boys cry, but cannot live in his world. â€Å"The man of snow is, nonetheless, content, having no wish to go inside and di e. Still, he is moved to see the youngster cry. † (cited in Clugston, 2010, â€Å"Boy at the Window† 9) The poem creates a feeling of fear and the unknown of what will happen in the afterlife. It is very sad to see a young child cry since they do not understand yet and will have to go through these hard life situations to really understand it. In the poem Wilbur made the character of the snowman human which created human characteristics to allow the reader get involved. Human nature brings out so many emotions with us and makes us feel compassion for others. An allusion is a reference a writer makes to a recognized literary work, a person, a historic event, or an artistic achievement to clarify the meaning of an action or a detail in a story, poem, or drama. † (cited in Clugston, 2010) The allusion is shown in Wilbur’s poem, â€Å"Return to him such a God-forsaken stare. As outcast Adam gave to paradise. † (cited in Clugston, 2010, â€Å"Boy at the Wind ow†, 7amp;8) This is a religious and biblical reference referring to Adam and Eve. Adam’s expulsion from the Garden of Eden represents believers of the scripture. I believe that he was making a statement of fear of not able to help the boy from fear and evil. The language is very strong in its meanings in this poem and makes you feel it with word choices. The temptations of entering their worlds would bring great harm and there was nothing they could do or say to be with each other. There is also a simile used in the line of Adam and the Garden of Eden allusion, the snowman is starring at the poor boy and cannot grasp him, just like Adam was looking at the paradise that was no longer his but just steps away. Irony is also characterized in this poem, the boy expects that the snowman will always be there as a friend. However, that was not the case, the snowman melted and died in the boys mind. The imagination language was very interesting and was full of surprise. The form of this poem was free verse, â€Å"This shown by its irregular rhythm and the lines vary in length and lack in rhyme,† it really made the reader follow the poem easily and made you stay interested in it. cited in Clugston, 2010) However, the author makes you feel that he is loved by the family by warmth inside, â€Å"For the child at the bright pane surrounded by such warmth, such light, such love, and so much fear. † (cited in Clugston, 2010, â€Å"Boy at the Window† 15) This makes you feel that the boy has so much fear of death, but still has loved ones to pick him back up. I feel that I could relate to this feeling since I have made so many snowmen in my childhood and lost them all. I can think ba ck and reminisce on how bad I felt when I saw my new friend disappear. Losing a loved one can be hard; I can relate this also to a child losing a pet, there are no words to even describe how painful it is. I lost a pet as a child and it tour my heart out since my pet would do anything just to stay with me, even if it meant suffering to no end. In life you have to experience hardship and bad situations, it is a learning curve and teaches you about life and death. Poems are so important in our society; they help to get feelings out and express real life situations in a poetic rhythm way. We face so many hard choices and have to let them be interpreted, â€Å"From an economic and cultural sphere increasingly dominated by finance capitol and advertising-gives it a chance to play a vital cultural role in an era of pressing ecological and ecological and economic crisis. † (Roberts, 2010) The use of the literary elements in Wilbur’s poem affects my response since he uses point of view from both the characters. He used his real life experiences to let the readers connect with his own feeling and this makes it more real. By using literary elements, it pulls out what message he is trying to get across in his poem.