The Art of the Renaissance Free Essays

The Art of The Renaissance by Maria Large Did you realize that most probable the most well known work of art on the planet, the Mona Lisa, was painted in the hour of the Renaissance? The oil painting of the straight confronted lady (or man), painted by the acclaimed Leonardo De Vinci, is supposed to be painted between 1503 to 1506. Nobody knows who the individual in the work of art is. Nobody even knows whether it is De Vinci himself, a family member or even a man or a lady! The English name â€Å"Mona Lisa†, originated from a depiction by Renaissance Art history specialist â€Å"Giorgio Vassar†. We will compose a custom exposition test on The Art of the Renaissance or then again any comparative theme just for you Request Now There were numerous dazzling works of art done in the timespan of the Renaissance. I’m going to quickly mention to you what occurred in the hour of the Renaissance and what styles or social angles impacted these skilled craftsmen. Likewise, how their confidence mirrored the work of art they made. The Renaissance previously happened in Italy, spreading all through the nations beginning roughly in the sass’s and closure around the sass’s. It was after the Middle Ages and after the Black Death had moved through numerous nations and in the end winding up in Europe murdering 1. O 4 million individuals altogether. The Renaissance was another uprising, it showed numerous things, for example, opportunity, autonomy, inventiveness, the resurrection of old style learning, the rediscovery of old Rome and Greece, and numerous different things. In the Middle Ages there were just sure religions permitted and certain methods of living. The individuals thought of the Middle Ages as a dim time however the Renaissance changed all that. They not, at this point needed the old ways so they changed numerous viewpoints and methods of living in this timeframe, including there own language. The Renaissance work of art was normally not accomplished for entertainment only or as a pastime. It was typically used to bring in cash or made for strict reasons. Just the artistic creations done by the experts hand would sell for huge cash, all others being of little worth. In those days, the congregation was a major piece of the pay, bringing about numerous works of art that were strict themed. They would offer their craftsmanship to houses of God and places of worship for cash. The greater part of the artworks were based off the Life of Christ, the Life of the Virgin, the Life of the Saint or Salvation. The artistic creations carried new plans to work of art, for example, â€Å"a feeling of space†, which makes your eye see 3 dimensional and furthermore the utilization of point of view. A major piece of the specialty of the Renaissance was strict based. The manner in which the specialists painted these canvases depicted confidence quite well, even to the point of making the humanists think otherworldliness as opposed to suspecting with human singularity. There were numerous well known strict compositions done in the hour of the Renaissance, for example, Leonardo De Vine’s artworks called, â€Å"The Last Supper† and â€Å"Virgin of the Rocks†. Another renowned bit of workmanship, is the painting of the â€Å"Sistine Chapel Ceiling† by Michelangelo. Additionally among his acclaimed works are his figures, â€Å"David†, speaking to the David in the holy book and â€Å"Pieta†, indicating Jesus dead body in the arms of his mom Mary. An intriguing reality about the artistic creations is that in the Middle Ages, due to the solid commitment to Catholicism, they were not permitted to consider the human body. After the Middle Ages finished, in light of the fact that individuals had more opportunity of religion, individuals began considering the human body, which brought about artistic creations that coked considerably more practical. As you have seen, the Renaissance was a major verifiable change for the individuals of that time just as the individuals of today. I have just referenced a couple of the numerous bits of fine art made during the Renaissance. The specialists and their works of art are still recalled right up 'til today. The styles of their work of art have influenced how individuals make there own specialty today. We can gain from the styles they utilized, their utilization of point of view, hues that demonstrated the timeframe, and even little things added to their ark that changed the entire imagine itself. In one sense, the craft of the Renaissance could be supposed to be the genuine start of craftsmanship and the pathway that was set for the future work of art that is made today. References: Art and Expression-Renaissance Art by Maria Lacy Kitchen Oracle Think Quest-The Renaissance Period by (obscure) Web Gallery of Art-Welcome to the Gallery by Emil Kern and Daniel Marx Renaissance by Thomas J. Gag, Harold E. Damager and Jose Marie Devalue BBC News-Is Ad Vine’s Mona Lisa a self-representation? By Nick Watt and Mama Snappily Step by step instructions to refer to The Art of the Renaissance, Papers

Legal Age for Alcohol Consumption Essay Example for Free

Legitimate Age for Alcohol Consumption Essay Various governments have age limits for legitimate utilization of liquor. For example, in most western states people underneath 18 years old ought not devour alchohol. Different nations have an age breaking point of 15 years (Miller, 2010). Every one of these legislatures have purposes behind setting this age necessities for liquor utilization. For instance, some contend that raising the legitimate age breaking point might not affect society, if individuals don't have the will and enthusiasm to stop untrustworthy drinking. Others contend that raising the lawful age breaking point would permit people to drink when they are adult and capable (Kolander, 2011). This would diminish odds of flippant drinking. I accept governments should raise the legitimate age necessity for liquor utilization, as a push to lessen the negative effects of liquor to society. I bolster raising as far as possible for liquor utilization. In any case, I likewise accept this can't be an effective measure to manage the negative effects of liquor to society, without utilizing different roads. For example, governments should actualize a program to teach the young on the negative effects of liquor. As per reports from various police offices, most youth devour liquor when they have not met as far as possible. This infers raising as far as possible must be powerful if guardians ingrain ethics in their little youngsters (Miller, 2010). Along these lines, the strict gatherings and the family have a monstrous task to carry out in controlling early utilization of liquor. Also, raising as far as possible for utilization of liquor will decrease the mischief of liquor on the strength of buyers. People experience the ill effects of ceaseless impacts because of liquor utilization when they approach it at early ages. For example, the peril that a person who began devouring liquor at 18 years old, is more serious than that of a person who began drinking at 25. Wellbeing specialists have asserted that early presentation to liquor utilization effectsly affects key inward body organs, contrasted with people who begin devouring liquor at late ages. Likewise, raising the legitimate age for liquor utilization decreases odds of enslavement, because of less introduction (Billings, 2010). Early presentation to liquor utilization has additionally prompted a decayed culture in the public eye. Families have separated because of untrustworthy drinking by kids, who wind up enjoying other crimes, for example, robbery, to fund their alcoholic conduct. At the current lawful prerequisite of 18 years, most youth might not have the accounts to fund their utilization of liquor. This causes them to rely upon their folks by misleading them, to get cash. If the guardians can't fulfill the monetary needs of the kids, the kids search for different alternatives to money related strength. Some go to the degree of stage overseeing captures to get cash from guardians. This has disintegrated the positive estimations of society, particularly the young, who are the biggest gathering of the world’s populace (Kolander, 2011). All in all, the above outlines show that early presentation to liquor utilization has more negative impacts than positives. For instance, people have a high likelihood of securing wellbeing intricacies, for example, lung and kidney diseases. Furthermore, early access to liquor utilization additionally dissolves the ethical quality of society. Moreover, early liquor utilization may likewise influence the scholastic existence of youthful grown-ups, who end up as addicts to liquor. These youthful grown-ups additionally face the danger of joining unlawful packs in the public eye. Consequently, it is sensible to propose that legislatures ought to consider reconsidering the lawful age limit upwards. Be that as it may, different organizations in the public eye should likewise help in easing the negative effects of liquor to society. Strict gatherings and the family ought to give guidance to youthful grown-ups on the risks of early liquor utilization. References Billings, S. (2010, October 24). Should the Legal Drinking Age Be Raised to 25 to Eliminate Deadly College Partying? Recovered July 19, 2012, from christwire.org: http://christwire.org/2010/10/should-the-lawful drinking-age-be-raised-to-25-to-dispose of destructive school celebrating/Kolander, R. W. (2011). Medication Abuse Prevention. New York: Jones Bartlett Learning. Mill operator, W. R. (2010). Reevaluating Substance Abuse: What the Science Shows, and What We Should Do

The Wall

The Wall Im in my room in Senior House (which, before you ask, is not just for seniors) right now. My walls are an uninteresting shade of white. I arrived on Saturday from Florida, where I was spending time with my family for the holidays. I had other plans for break, but they fell through, so I decided to come back here a little early to go see an AMAZING concert and spend New Years in a place that I wasnt allergic to. (No, really, Im convinced Im allergic to Florida. Ive never had allergies anywhere else. They started when I arrived and were gone hours after arriving back in Boston. Too bad it turns out that Florida is a pretty cool place, despite the heat. I really like how much nature is accessible there.) As I was saying. The walls. My room. I have a single, and strangely shaped though it may be (there arefourteen corners in my room, but its still pretty much a rectangle. Have fun figuring that one out), I quite like it. I have a view of the Media Lab and of the construction next to the Media Lab, which was great for waking me up at 5am back in the fall. My single is in a suite. This can mean different things across dorms I think Burton-Connor suites make up different floors and have kitchens or something like that but in Senior House, this means I share a lounge with three other people. Normally, its several more something like five or six, but my suite is somewhat of an architectural anomaly within Senior House. One of the cool things in this dorm is that were allowed to paint the walls (and have cats and smoke, if youre into that). As a result, there are a myriad of cool murals and interesting decorations in Senior House. One of the not so cool things is that recent renovations resulted in a lot of walls being painted over and murals lost. Anyway, Im still new here and dont know for sure whether my suite was ever painted. But at this very moment right, you remember. Uninteresting walls. My suitemate and I considered painting in the beginning of the year, but we were far too lazy and decided to leave this endeavor for IAP, which youll hear more about as it occurs. Now January is fast-approaching (actually, its here. Oops), and I have to decide whether this is something I really want to do. Interesting walls do not make a person, and the money could honestly be put to better use on a lot of things, but at the same, well, I love color. The point Im trying to emphasize here is that I really appreciate the fact that I have so much freedom to choose what I do here. I can paint the walls, I could have a cat (theoretically. But only cats. And fish), I could live in a double or a single or a suite, I could paint a mural on the walls. Just another thing to think about when it comes time to choose your living groups (because, you know, its only eight months from now ;) This has to be the most awkwardly timed blog entry in the world. All of you have finally submitted your applications and probably celebrated the coming of the New Year, and here I am talking about my walls. I have a lot to say about the end of first semester, and I plan on actually saying it soon because I have time now, instead of thinking about saying it but actually falling asleep like Ive been doing for the past month. Of course, by I have time I actually mean that I have more time than I did before, which was none, so its not actually saying much because I still have an Arabic final a week from now, but Ill still have plenty of time for you all, my pretties. (Harvards finals schedule does not correspond with ours. Which, if I were you, would be a huge deterrent for taking classes there. But dont worry, thats changing soon, so it wont affect you much.) Anyway, the time that I have happens to be running out for tonight because I still have a lot of studying to do. I hope you all have a relaxing break, and a great start to your last semester of high school. :) Post Tagged #Senior Haus #Senior House

Compare Lamb to the Slaughter and The Speckled Band Essay

Murder mysteries - Compare Lamb to the Slaughter and The Speckled Band. Murder mysteries all have a similar plot consisting of a body, a motive, a weapon, a suspect, an alibi, and detectives. Viewers and readers expect this in the text, Lamb to the Slaughter and The Speckled Band are no exception. The structures of the two stories are very different, with The Speckled Band story unfolding in chronological order, finding out the murderer right at the end, however in the Lamb to the Slaughter, the murderer is known at the beginning of the story. The two stories are seen from two different points of view, first-person narrator in The Speckled Band as Dr Watson character within the story and therefore limited in understanding†¦show more content†¦Also in The Speckled Band, Dr Roylott, is the evil, plotting, devious, fictional murderer; this character was portrayed in most murder mysteries stories written in the late 19 century. The Speckled Band was written in 1892. In the Lamb to the Slaughter we had no idea who the murderer and victim were going to be until the murder had been committed, in fact you might of thought the roles would have been reversed once reading the first few pages. The detectives in the story are portrayed as acting as typical modern police detectives, they eat the evidence! The detectives appear so stupid and useless compared to the marvellous and calculating Sherlock Holmes. The points of high tension are different in the two stories. In The Speckled Band the main point of high tension is right at the end when they find out who the murderer is and when the snake comes at Holmes Holmes sprang from the bed, struck a match, and lashed furiously with his cane at the bell-pull. Other points of tension were Helen Stoner talking to Holmes, Frightened eyes like those of some hunted animal, the night of the murder, A wild wind. The wind was howling outside suddenly there burst forth the wild scream of a woman, and the sisters hot words, She suddenly shrieked out in a voice which I shall never forget, O, my God! Helen! It was the band! The Speckled band! In the Lamb to the Slaughter the point of high tension is whether the detectives wouldShow MoreRelated Compare and Contrast Lamb to the Slaughter and The Speckled Band1392 Words   |  6 PagesCompare and Contrast Lamb to the Slaughter and The Speckled Band ‘Lamb to the Slaughter’ and ‘The Speckled Band’ are both written is separate eras and cultures, and these differences are reflected in the way the authors use language, structure and moral techniques in their stories. How ever, there are some similarities in these stories as both are of the thriller genre. The story ‘Lamb to the Slaughter’ is about a husband and a wife whose relationship comes to a sudden halt. The sweetRead MoreMurder Mysteries Essay2434 Words   |  10 PagesHow Far Are The Speckled Band And Lamb To The Slaughter Typical Of Murder Mysteries? How Are The Stories The Same And How Are They Different? Compare The Ways In Which The Stories Are Told Murder mystery usually means where there is a murder involving money, love or revenge. The victims friend or a family member goes to a detective and tells them what they know about the murder and the suspects and where they were, and what they were doing at that time. There are a lot of famous detectivesRead MoreAtmosphere and Tension in The Speckled Band by Air Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl2251 Words   |  10 PagesAtmosphere and Tension in The Speckled Band by Air Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl Both the stories I am analysing are murder mysteries and they are set in very different time periods. Summary of stories lamb to the slaughter The lamb to the slaughter was a murder mystery story based on a troubled couple. Mary Malone is a keen housewife who is deeply in love with her husband and will do nearly anything to please him. Her husband isRead MoreThe Speckled Band by Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl2642 Words   |  11 Pageshistorical context of each text reflected in The Speckled Ban by Arthur Conan Doyle and Lamb to the Slaughter by Roald Dahl. In this essay, I intend to compare and contrast the two short stories The Speckled Band by Sir Arthur Conan-Doyle, and Lamb to the Slaughter by Roald Dahl, picking out techniques used which make it exactly, or exactly the opposite of a typical detective story/murder mystery. Both The Speckled Band and Lamb to the Slaughter have ingredients for a detective story

Rna Extraction Cdna Synthesis And Real Time Pcr For...

RNA extraction, cDNA synthesis and real-time PCR for Smad3 gene Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript  ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 - AGGGCTTTGAGGCTGTCTACC-3 ) and reverse primer (5 - ACCCGATCCCTTTACTCCCA -3 ) (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5†²-GGTGAAGTTCGGAGTCAACGGA-3†²) and reverse primer (5†²-GAGGGATCTCGCTCCTGGAAGA-3†²) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA). Statistical analysis Statistical analysis was conducted as mean and standard deviation using Statistical Package for Social Sciences (SPSS), version 16.0 for Windows (SPSS, Chicago, IL).Show MoreRelatedEnvironmental Pollutants, Drug And Ionizing Radiation Causes Inflammation And Oxidative Stress1951 Words   |  8 PagesSmad proteins act as primary mediators of inflammatory and fibrotic response [4].Carnosine (ÃŽ ²-alanyl-L-histidine) is a dipeptide with anti-ischemic, anti-oxidant, membrane stabilizing, heavy metal chelating activities, and reduces matrix proteins synthesis such as fibronectin, collagen of podocytes and mesangial cells [5,6]. Material and methods This research was carried out in accordance to the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publications

The war which the world feared upon never happened Free Essays

The war which the world feared upon never happened, the Cold War. United States of America and the Soviets are preparing for this battle as who among these super powers will really dominate the world. As a means of preparation they are to dominate the seas, especially the under sea navigational fleet, the Submarines. We will write a custom essay sample on The war which the world feared upon never happened or any similar topic only for you Order Now American leaders as a means of preparing for battle put their trust and confidence in their submarine force. Empowered by their own power plants these nuclear submarines are to dominate the seas with unbelievable sophistication and with weapons of incredible destructive power. The idea of submarine came from the Germans who were the ones who pioneered in the creation of the vessel during World War II (Weir, 1998). The US Navy has envisioned that submarines of the future would go deeper and move much faster. Thus as the years passed, the nuclear submarine was created. Under the US military force, the main mission of the first known SSBNs or â€Å"Ship Submersible Ballistic Nuclear† was for the prevention of war to happen. They are to be deployed to strategic sites for them to guard and thus to prevent war   (Weir, 1998). Because of their relentless power, as the nuclear is used to propel them, they have the capability to submerge and circumnavigate the world with fewer expenses. They can submerge for number of days to avoid detection and can easily guard strategic sites as their main mission. They are considered as the guardians of a possible nuclear war. According to David Munns in his book, the greatest advantage so that submarines, armed with ballistic missiles, can release its relentless power is that they have to be close to the shore. This idea was the main basis for the development of the undersea military force of both United States and the Soviet Union. Throughout the 45-year Cold War both countries developed submarines, especially nuclear powered, to gain intelligence or for espionage, due to its stealth power, and to attack and destroy any possible enemy surface ships. Its powerful ballistic missiles have the ability to attack ground or land based targets. Both countries develop such powerful undersea fleet and were considered as the most potent nuclear threat for both of them. (Munns, 2004) The main idea was that to counter this powerful surface warships and nuclear propelled missile cruisers and aircraft carries they have to develop more powerful underground fleet (Munns, 2004). With the development of the nuclear power, the first ship that was ever built by the Americans that went to sea is the USS Nautilus. It went to sea on January of 1955. It is propelled by pressurized-water nuclear reactor plant. This firs submarine built by the Americans sets the new standard for submarines (Huchtausen, 2002). The Russians on the other hand, built their first submarine which went to sea on a much later date. The K-3 or also known as Leninsky Komosol, it is a part of the November class of attack submarines only went to sea only on 1958. This submarine was the first Soviet sub who have reached the North pole, only in 1962, which the United States first sub USS Nautilus have already done four years earlier. The November class submrines however had serious problems one example was the accident happened in 1968 of its K-27 due to a radioactive gas lead which killed 9 people (Huchthausen, 2002). The next Class of submarines that was built by the Americans was the Skipjack Class Submarines. Built in 1959, this attack submarine was the first to combine nuclear power which has extraordinary speed. This is more hydronamic which has a new teardrop hull design. All other US submarines that was created was based on this design. The known accident that happened for this class of submarine was on May 21, 1968 when the USS Skipjack Scorpion was lost in the sea and was nowhere to be found even due to extensive military search. All the 99 people aboard the submarine also lost their lives (Compton-Hall, 1999). The Soviet built the Hotel-class submarines on 1960. This is the first Soviet Nuclear subs which carries with it ballistic missiles. The design of the November Class is much similar to that of the November class, but with much larger compartment to accommodate the ballistic missiles (Compton-Hall, 1999). On the same year the Skipjack Class was created, the US Military built the USS George Washington Class. Built and deployed on 1959, this submarine was the first Nuclear Ballistic missile submarine which was created. The main idea for this ballistic missile submarines was that it would attack land-based targets with its nuclear weapons. They are to be deployed near shore targets so that their long range missiles can easily hit their targets. The Soviets then build the Victor Class submarines in 1967. Their design was to attack enemy submarines and to protect surface ships of the Soviets. The new teardrop hull enabled the Victor Class to attain higher speed. The Soviets however abandoned the construction of the second Victor submarine design after learning through spy information that the NATO forces could easily track them (Compton-Hall, 1999). Due to this, the Soviets created the Victor III submarine. The Americans on 1961 built the Thresher Class attack submarines. This submarine is much stronger, much faster, and can dive much deeper. It is also designed to be quieter than the Skipjack Class, the materials used in this class have more streaming improvements. The name was however changed from Thresher Class to Permit Class when the submarine Thresher sank in New England in 1963 killing all 129 crew (Huchtausen, 2002). In 1967, the Soviets created the Yankee Class submarines. This is the first Submarine that has the same firepower as that of the US submarines. This is much quieter than the Hotel Class due to a new hull shape, a new propeller design, and exterior sound-deadening coatings which is much harder to track. Several modifications were also made on this class, with its big design it was enabled to carry miniature submarines. On 1976, the Americans built and deployed the Los Angeles class. This class had 62 vessels built and is considered as the world’s largest nuclear-propelled submarine. This class was designed to primarily protect carriers and other enemy submarine. The purpose of this submarine was the same as that of the Soviet’s Victor Class. This submarine however was much more powerful than the Victor class because of its capability to do other special missions such as deployment of Special Forces on the ground and attacking larger targets. The Los Angeles class was also improved for better ice operations on the North and South Pole (Compton-Hall, 1999). The next class built by the Soviet and one of the last Class is the Typhoon class submarine. During its time, in 1981, it was considered as the world’s largest attack submarine. This improved design which is much quieter compared to its size. This submarine is also more maneuverable even if it is huge. The design of this submarine is much more complicated due to the existence of two pressure hulls which is parallel with each other and a third hull which is on top of them. This design increases its width and had simplified internal arrangements. Being part of a cooperative arms reduction program of the former Soviet states, six of the Typhoon class was dismantled in 2003 (Compton-Hall, 1999). The Ohio-class submarine is the last among the long line of designs of the ballistic-missile submarine fleet of US.   It replaced the old 1960s version and was larger and more capable than its precedents.   These subs can carry more and longer-range weapons, operate more quietly, and dive deeper (Compton-Hall, 1999).   Russia, on the other hand, designed the contemporary of Ohio, the Oscar submarines.   These are Russia’s largest and most advanced and are still active submarines.   Designed to attack U.S. aircraft carrier battle groups, it carries three times as many antiship cruise missiles than its predecessors (Compton-Hall, 1999). Norman Polmar and K.J. Moore, were two naval officials under the US Armed Forces who were interviewed by Munns in his book. They said that â€Å"the United States and the Soviet Union put to sea a combined total of 936 submarines, of which 401 were nuclear propelled,† during the whole Cold war from 1945-1991 (Munns, 2004). The Soviet Union was the one who is aggressive in the development of submarines. This development still continues until after the 1970’s where research and effort to make the vessels more powerful were developed. From the mid-1940s until early 1990s, Cold War was a period of conflict and competition between two superpowers, the United States and the Soviet Union.   It was also a period of great technological advancements in the military with no less than the development of nuclear submarines.   Faster, quieter and deadlier weapons were developed. It was also this same period which placed the entire world on edge. And knowing the potentials of these weapons, the war that never happened also brought unparalleled relief to mankind. WORKS CITED: Compton-Hall, Richard. The Submarine Pioneers. Sutton Publishing, 1999. Huchthausen, Peter. K-19: The Widowmaker—The Secret Story of the Soviet Nuclear Submarine. National Geographic Books, 2002. Munns, David W. Sea Power. May 2004. Retrieved at http://findarticles.com/p/articles/mi_qa3738/is_200405/ai_n9345820 Polmar, Norman and Moore,K.J. COLD WAR SUBMARINES: The Design and Construction of U.S. and Soviet Submarines.   Dulles, Va.: Brassey’s, March 2004. 336 pp. Weir, Gary E. Deep Ocean, Cold War. Washington: Brassey’s, 1998. Evolution of Subs: U.S. and Soviet Submarine Milestones of the Cold War. National Geographic. http://www.nationalgeographic.com/k19/evolution_main.html http://www.navy.mil/navydata/cno/n87/usw/issue_7/deepocean.htm How to cite The war which the world feared upon never happened, Essay examples

Boy at the Window free essay sample

The author explains in our textbook that it was written, â€Å"After seeing how distressed his five-year old son was about a snowman they had built. † (cited in Clugston, 2010) The message and theme is about how a little boy becomes sad after building a snowman and seeing him outside all alone and sad. Wilbur uses different literary elements to draw strong emotions and express fear of losing a friend/loved one. The author shows us two different points of view in this poem, first with the young boy and then with the cold snowman. In the first few lines the reader thinks that the young boy is crying about the snowman and how petrified he may be. The boy sees the snowman, while looking out his window he is all alone and by himself. Then the wind is heard from the boy picking up and starts feeling what the snowman might be feeling. There is so much compassion and heartbreak that the boy feels for the snowman at this time. The use of personification is shown while Wilbur states, â€Å"the pale faced figure with bituemen eyes return him a God-forsaken stare. † (cited in Clugston, 2010, â€Å"Boy at the Window†, 6) I believe the author Wilbur was creating a unique situation; he uses great personifications for the snowman. Personification is a figure of speech formed when qualities normally associated with a person are attributed to abstract things or inanimate objects. † (cited in Clugston, 2010) The snowman is the conent, he did not want to go inside the house yet as he looked at the young boys cry. Since the snowman would melt if he went into the heated room, he decides to stay outside even though the boy was crying. However, the snowman’s heart is moved from the boys cry, but cannot live in his world. â€Å"The man of snow is, nonetheless, content, having no wish to go inside and di e. Still, he is moved to see the youngster cry. † (cited in Clugston, 2010, â€Å"Boy at the Window† 9) The poem creates a feeling of fear and the unknown of what will happen in the afterlife. It is very sad to see a young child cry since they do not understand yet and will have to go through these hard life situations to really understand it. In the poem Wilbur made the character of the snowman human which created human characteristics to allow the reader get involved. Human nature brings out so many emotions with us and makes us feel compassion for others. An allusion is a reference a writer makes to a recognized literary work, a person, a historic event, or an artistic achievement to clarify the meaning of an action or a detail in a story, poem, or drama. † (cited in Clugston, 2010) The allusion is shown in Wilbur’s poem, â€Å"Return to him such a God-forsaken stare. As outcast Adam gave to paradise. † (cited in Clugston, 2010, â€Å"Boy at the Wind ow†, 7amp;8) This is a religious and biblical reference referring to Adam and Eve. Adam’s expulsion from the Garden of Eden represents believers of the scripture. I believe that he was making a statement of fear of not able to help the boy from fear and evil. The language is very strong in its meanings in this poem and makes you feel it with word choices. The temptations of entering their worlds would bring great harm and there was nothing they could do or say to be with each other. There is also a simile used in the line of Adam and the Garden of Eden allusion, the snowman is starring at the poor boy and cannot grasp him, just like Adam was looking at the paradise that was no longer his but just steps away. Irony is also characterized in this poem, the boy expects that the snowman will always be there as a friend. However, that was not the case, the snowman melted and died in the boys mind. The imagination language was very interesting and was full of surprise. The form of this poem was free verse, â€Å"This shown by its irregular rhythm and the lines vary in length and lack in rhyme,† it really made the reader follow the poem easily and made you stay interested in it. cited in Clugston, 2010) However, the author makes you feel that he is loved by the family by warmth inside, â€Å"For the child at the bright pane surrounded by such warmth, such light, such love, and so much fear. † (cited in Clugston, 2010, â€Å"Boy at the Window† 15) This makes you feel that the boy has so much fear of death, but still has loved ones to pick him back up. I feel that I could relate to this feeling since I have made so many snowmen in my childhood and lost them all. I can think ba ck and reminisce on how bad I felt when I saw my new friend disappear. Losing a loved one can be hard; I can relate this also to a child losing a pet, there are no words to even describe how painful it is. I lost a pet as a child and it tour my heart out since my pet would do anything just to stay with me, even if it meant suffering to no end. In life you have to experience hardship and bad situations, it is a learning curve and teaches you about life and death. Poems are so important in our society; they help to get feelings out and express real life situations in a poetic rhythm way. We face so many hard choices and have to let them be interpreted, â€Å"From an economic and cultural sphere increasingly dominated by finance capitol and advertising-gives it a chance to play a vital cultural role in an era of pressing ecological and ecological and economic crisis. † (Roberts, 2010) The use of the literary elements in Wilbur’s poem affects my response since he uses point of view from both the characters. He used his real life experiences to let the readers connect with his own feeling and this makes it more real. By using literary elements, it pulls out what message he is trying to get across in his poem.

The poem Ithaca Essay Example

The poem Ithaca Paper One of the most important messages expressed in the poem is that the Journey is the important part, therefore it does not matter if the goal is achieved but it matters that something is learnt on the journey to achieve it. One of the joys mentioned in the poem is to visit many Egyptian cities, to gather stores of knowledge from the learned. In the ancient world, Egypt was a center of learning, especially its capital city, Alexandria, which was one of the largest cities in the world and contained the largest library. This is a form of imagery that is used to show that when new places are visited, or new experiences are completed a persons knowledge will always increase. Have Ithaca always in your mind. Your arrival there is what you are destined for. Any traveler of the journey of life, must always keep Ithaca in mind, because it is his or her final destination, their ultimate aim. Without it there would be a lack motivation, which would lead to a minimum amount of goals being completed which means when Ithaca is reached a person will look back at their journey and be regretful. We will write a custom essay sample on The poem Ithaca specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on The poem Ithaca specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on The poem Ithaca specifically for you FOR ONLY $16.38 $13.9/page Hire Writer The journey to Ithaca should not be hurried, and it is better that it last many years, so that the traveler is old by the time he reaches the final destination and has gained many things from their journey. This is due to the fact that throughout that extra time an Individual can achieve more goals have more adventures and gain more knowledge. However an Individual should not be expecting Ithaca to give you wealth. Ithaca gave you a splendid journey. Without her you would not have set out. She hasnt anything else to give you. This is because throughout the journey to reach Ithaca an individual should have achieved everything that they wanted to so that by the time they reach the end of their journey, or life, there will be nothing left for them to regret and they will be perfectly contend with their lives and what they have achieved. And if you find her poor, Ithaca hasnt deceived you. , because Ithaca has already gifted you, by being your goal, with so many thing and experiences that there will be nothing that Ithaca can give you due to the fact you will already have all you wanted. The Author believes that for a person to have a truly accomplished life and have no regret they most have goals and aims, with their final aim being Ithaca. Individuals should aim to experience the most out of their lives, and should realize that small things compared to big things in life can be just important. Throughout the journey of life there will be challenges and problems that will get in the way of an individual achieving their goals, but they should not let them get in their way of their final aim but count them as another step to accomplish it. Even if all goals are not completed as planned it does not matter for the journey to Ithaca is the important part, due to the fact that once the individual reaches Ithaca they will have gained knowledge and experience They should also have no regret. This is the gift Ithaca gives you. So wise you have become, of such experience, that already youll have understood what these Ithacas mean

Overview of Viking Trading and Exchange Networks

Overview of Viking Trading and Exchange Networks The Viking trade network included trading relationships into Europe, Charlemagnes Holy Roman Empire, into Asia, and the Islamic Abbasid empire. This is evidenced by the identification of items such as coins from North Africa recovered from a site in central Sweden and Scandinavian brooches from sites east of the Ural Mountains. Trade was a vital feature of the Norse Atlantic communities throughout their history and a way for the colonies to support their use of landnam, a sometime unreliable farming technique for environments the Norse didnt quite understand. Documentary evidence indicates that there were several groups of specific people who traveled between the Viking trading centers and other centers throughout Europe, as envoys, merchants or missionaries. Some travelers, such as the Carolingian missionary bishop Anskar (801-865) left extensive reports of their travels, giving us great insight to traders and their clients. Viking Trade Commodities The Norse traded commodities included slaves, but also coins, ceramics, and materials from specialized crafts such as copper-alloy casting and glass-working (beads and vessels both). The access to some commodities could make or break a colony: Greenlands Norse relied on trade in walrus and narwhal ivory and polar bear skins to support their ultimately failing farming strategies. Metallurgical analysis at Hrisbru in Iceland indicates that the elite Norse traded in bronze objects and raw material from the tin-rich regions in Britain. Significant trade in dried fish emerged near the end of the 10th century AD in Norway. There, cod played a significant role in Viking trade, when commercial fishing and sophisticated drying techniques allowed them to expand the market throughout Europe. Trade Centers In the Viking homeland, major trading centers included Ribe, Kaupang, Birka, Ahus, Truso, Grop Stromkendorf, and Hedeby. Goods were brought to these centers and then dispersed into the Viking society. Many of these site assemblages include an abundance of a soft yellow earthenware called Badorf-ware, produced in the Rhineland; Sindbà ¦k has argued that these items, rarely found on non-trading communities, were used as containers to bring goods to places, rather than as trade items. In 2013, Grupe et al. conducted stable isotope analysis of skeletal material at the Viking trade center of Haithabu (later Schleswig) in Denmark. They found that the diet of the individuals expressed in the human bones reflected the relative significance of trade over time. Members of the earlier community showed a predominance of freshwater fish (cod imported from the North Atlantic) in their diet, while later residents shifted to a diet of terrestrial domestic animals (local farming). Norse-Inuit Trade Theres some evidence in the Viking Sagas that trade played a role in the North American contact between the Norse and the Inuit occupants. Also, Norse symbolic and utilitarian objects are found at Inuit sites and similar Inuit objects in Norse sites. There are fewer Inuit objects in Norse sites, a fact which may be because the trade goods were organic, or that the Norse exported some Inuit prestige items into the wider European trade network. Evidence at the site of Sandhavn in Greenland seems to suggest that the quite rare co-existence of Inuit and Norse there was a result of the opportunity to trade with one another. Ancient DNA evidence from the Farm Beneath the Sand (GUS) site, also in Greenland, however, finds no support for the trade of bison robes, posited earlier from morphological examination. Viking and Islamic Trade Connections In a 1989 study of formal weights discovered at the Viking site of Paviken in Gotland near Vastergarn, Sweden, Erik Sperber reported three main types of trading weights in use: Ball-shaped weights of ironclad with a layer of bronze or solid bronze; these vary between 4 and 200 gmCubo-octaedric weights of lead bronze, tin bronze or brass; up to 4.2 gramsLeaden weights of different shapes and sizes Sperber believes at least some of these weights conform to the Islamic system of the Ummayyad dynasty leader Abd al Malik. The system, established in 696/697, is based on the dirhem of 2.83 grams and the mitqa of 2.245 grams. Given the breadth of Viking trade, it is likely that the Vikings and their partners may have utilized several trade systems. Sources: This glossary entry is a part of the About.com Guide to the Viking Age and part of the Dictionary of Archaeology.Barrett J, Johnstone C, Harland J, Van Neer W, Ervynck A, Makowiecki D, Heinrich D, Hufthammer AK, Bà ¸dker Enghoff I, Amundsen C et al. 2008. Detecting the medieval cod trade: a new method and first results. Journal of Archaeological Science 35(4):850-861.Dugmore AJ, McGovern TH, Và ©steinsson O, Arneborg J, Streeter R, and Keller C. 2012. Cultural adaptation, compounding vulnerabilities and conjunctures in Norse Greenland. Proceedings of the National Academy of Sciences 109(10):3658-3663Golding KA, Simpson IA, Schofield JE, and Edwards KJ. 2011. Norse-Inuit interaction and landscape change in southern Greenland? A geochronological, Pedological, and Palynological investigation. Geoarchaeology 26(3):315-345.Grupe G, von Carnap-Bornheim C, and Becker C. 2013. Rise and Fall of a Medieval Trade Centre: Economic Change from Viking Haithabu to Medieval Schleswig Revealed by S table Isotope Analysis. European Journal of Archaeology 16(1):137-166. Sindbà ¦k SM. 2007. Networks and nodal points: the emergence of towns in early Viking Age Scandinavia. Antiquity 81:119-132.Sindbà ¦k SM. 2007. The Small World of the Vikings: Networks in Early Medieval Communication and Exchange. Norwegian Archaeological Review 40(1):59-74.Sinding M-HS, Arneborg J, Nyegaard G, and Gilbert MTP. 2015. Ancient DNA unravels the truth behind the controversial GUS Greenlandic Norse fur samples: the bison was a horse, and the muskox and bears were goats. Journal of Archaeological Science 53:297-303.Sperber E. 1989. The weights found at the Viking Age site of Paviken, a metrological study. Fornvannem 84:129-134.Wrmlnder SKTS, Zori D, Byock J, and Scott DA. 2010. Metallurgical findings from a Viking Age chieftain’s farm in Iceland. Journal of Archaeological Science 37(9):2284-2290.

Project management review Essay Example | Topics and Well Written Essays - 4000 words

Project management review - Essay Example Once the system has been built to last, it is likely to contribute significantly to the operations of the central government in tracking large projects. However, a holistic approach needs to be taken in order for this project to be a resounding success. The phases outlined above need to be carefully taken into account. It can also be seen that project managers should possess various skills that can enable them to execute different project. These people should have effective communication skills as well as the ability to solve problems in order to succeed in carrying out this project. Table of contents 1.0 Introduction 3 1.1 Task A: Project definition 5 1.2 Project life cycle 5 1.3 Project scope, aims and objectives 6 2.0 Task B: approach to project management 8 2.1 Good approach versus bad approach to project management 8 2.1.1 Project definition 8 2.1.2 Agreement 9 2.1.3 Support 9 2.1.4 Communication 9 2.1.5 Measures to control risk 10 2.2 Project processes 10 2.3 Initiation 10 2.4 Planning 11 2.5 Execution and controlling 12 2.6 Monitoring and close out 13 3.0 Task C: Definition of control system 14 3.1 Effectiveness of the control system 15 3.2 How risk is handled 16 4.0 Task D: Qualities of an effective project manager 17 References 19 1.0 Introduction In order to understand the concept of project management, it is imperative to begin by defining the meaning of project. Basically, â€Å"a project is a special kind of activity and it involves something that is both unique and important and thereby requires unusual attention. It can also be noted that it has boundaries and has a beginning and an end,† (Flemming 2003, p.3). Thus, for any project to achieve its goals, it can be observed that project management is essential and it should be implemented in every stage of the project. It can be observed that there are various activities that are involved in the process of project management. According to Fox (2008), project management is a combination of st eps and techniques for keeping the goals and objectives, budget and schedule in order so as to achieve the desired outcome. A lot of project management tools are used in order to manage the project effectively so that the set goals and objectives can be achieved. The success of a given project mainly depends on the manager’s capability to control the different phases of the project such that all the efforts of the people involved are directed towards the achievement of the desired goals. All activities need to be properly managed so that they can be successfully implemented in the project. A project is characterised by the following factors: initiation, planning, execution as well as monitoring and closing out. These factors are very important in the execution of any given project and they determine its success or failure in most cases. Each phase in a project needs to be properly controlled such that the chances of achieving the desired goals are increased. The other advanta ge of controlling each stage is that necessary adjustments can be made along the way so that the objectives of the project are met. Effective project management entails that proper measures are put in place in order to deal with all the unprecedented changes that may be encountered during the course of the project. Project management also entails that all activities are controlled so that they remain within the set budget work the

Real World Negotiation Paper Assignment Example | Topics and Well Written Essays - 1500 words

Real World Negotiation Paper - Assignment Example Additionally, the increase would also see my employer acquiring maximum and satisfying service from me. Informed by the fact that successful negotiation is mainly realized through proper preparations, possess effective communication skills, being able to control emotions and having greatclossing the deal skills, I embarked on the quest for having a salary increase. As part of my preparation to face her and negotiate for my salary increment, I prepared myself in various ways as I have discussed below: I started by preparing a logical argument and evidence that could support and make my claim logical. Informed by the fact that activities key during the preparation process include developing position of strength, and establishing a foundation for success and developing confidence, I chose to start my preparation by coming up with a very strong argument as to why I felt the urge to approach my employer and demand for salary increase and why I stood a chance to see my salary being increas ed without much objection. I went on to compose evidence that will support all my arguments although in order to make my demand reasonable and realistic. I also considered my argument to be the demand for the increase to be because of rise in the cost of living and the supporting evidence was that other employers within the region had seen their salary being increased, inflation had resulted to the fall of value of money which in turned had reduced my purchasing power and therefore the amount I was being paid did too little to satisfy all my needs, there was also a general increase in price of commodities which demanded for more money than I was earning before and finally that it was also meant to be a sign of appreciation to for the good job the I had been doing for my employee for so long. I also went on to consider the amount of salary increase that I expect. I went on with my preparation process of computing and coming up with an amount of money that I was to propose as my incre ment. I choose to come up with the maximum amount and reasonable amount of my salary increase that I expected from my employer and also the minimum amount that I was to expect in the course of the negotiation process. As part of my preparation I also choose to come with a formal letter and send it early enough to notify and prepare my employee over the setting of the negotiation date and this was also meant to prepare my employer psychologically over considering my pay rise. Since my employer was never around and were never met so easily, I also considered my grooming as part of my preparation. This was because my personal appearance and outlook was also to play an important at either building my reputation or destroying it. I also knew that smartness played a critical role towards boosting my confidence. During the negation day, all went well and as planned, the negotiation date was set in advance and in consideration to the schedule of both sides not interfering with the any of ou r activities. On the negotiation d

Performance management

Performance management PART B Process Performance planning Performance monitoring Performance development Performance evaluation Succession planning Ans. 1 Performance planning means the different steps or stages which are used for the organisation success. In which the manager discuss all things like future plan, goals, targets and objectives with their all company members. It play crucial role in organisation because it is used to setting the organisation goals and objectives to achieve its objectives. Moreover, it play significant role to make a good relationship between the employee and their manager and supervisor. The company that I have chosen can create a performance planning for the organisation success. They can create a performance planning by helping the employee and manager and supervisor to understand their jobs and organisation objectives. In addition employee can communicate with their supervisor or manager about their performance and supervisor can make performance planning for goals with the help of employees. Furthermore, supervisor can check that employees have all types of resources that are require for the o rganisation success. Moreover, there goals should be smart which help them for organisation success. Last but not least, supervisor communicate with their management about the company goals and competencies and career development activities about the employees. Ans. 2 Performance monitoring means checking or measuring the performance of the employee and giving them feedback to employees about their work, office support and some guidance on their work performance toward to reach the organisation goals. Moreover, it means the organisation work and project are monitor continually. The company that I have chosen can complete the performance monitoring by assisting the company to measure its progress by taking reviews with the employees whether they are doing good work or not. In addition, they compared their performances against their standard and element they set for the organisation goals. They can do every day monitoring that gives a lot of benefits. We can check how our workers are doing their work whether they meeting the organisation goals or not. Furthermore, we can check problems in the work and we can make some changes in work to reach the organisation objectives and goals. We can also change unrealised and standard problems. Last but not least, Monitoring continually we can identified some unacceptable problems in work. Ans. 3 Performance development means the improving the capacity of work performance of employees by giving training or providing new skills and higher level of responsibilities, it is very important for the company to improve the work process. In addition, company should provide development opportunities to the employees. Moreover, company can identified the development needs of employees. The company that I have chosen can complete the performance development by encouraging the employee’s performance. Furthermore, they can strength the skills which are related to job need employees for the development. In addition, company helps their employees to keep with them. Moreover, they are introducing new technology which are used for the company development and helping the employees for work. Due to performance development, every employees can identify their strength and performance because of resources and capability framework which are provided by the company to them. Ans. 4 Performance evaluation means to review the employee performance after 12 month. It is very important for company because it is used to review or evaluate the company annual performance whether the company making profit or not. It is used to review the job performance. It is used to evaluate the past performance. The company that I have chosen can complete the performance evaluation by discussing expectation and accomplishment of organisation. This can assist the company to improve its retention of staff by HR development strategies, policies and development. In addition, we can improve it by the expertise and experience employed in the organisation. Last but not least, the company can improve it by comparing and rating the employee’s performance. Ans.5 Succession planning means that the process of checking that business is going or running successfully without the people. This is very important because if the business is not reliant on the person and owner knowledge they will get the better sale. These type of planning are complicated and emotionally difficult. The company that I have chosen can complete the succession of planning by developing the chance of business growth and challenging. The company can assist to improve the retention of the staff by asking the right questions and put realistic value on the business. Moreover, they can improve by setting the achievable time framework for employees to make plan. Last but not least, they can do it by providing the best resources to the employees. Progressive warning system Ans.1 Ans.2 The progressive warning system means to assist the employees to understand the problems at workplace for the improvement of the company. For the new employees it means If the employees did mistake the employer ask first why this happened and give verbal warning to employee. If the employees did simple mistake the employer give them written and verbal warning. For the serious mistake employer give suspension order for short term and may be discharge the employees. The employee know that employer consider their small or serious problem by when the company profit goes down and when they did wrong work and when the company work is not improving. Ans.3 Progressive warning system for new manager means to correct the employee performance problems. It means for the new manger first they discuss the problems with the employees and ask them why this problem occurred and how. If the simple mistake is made by employees the manager will discuss problems with the employees which are not good and unsatisfactory. They warn the employees to take action which are lead to further action. If the serious mistake is made by the employees manager warn the employee and take action. Manager will put the copy of warning letter, time and date of its issue to the employee’s personal file. The steps that manager must take when the serious problem occur first they give the verbal warning and second they give the written waning which is reason for the continuing mistake. Moreover, they give the final written warning which is put in employee’s personal file and if they did mistake again the employee will be dismissed. Ans.4 Ans.5 Personal grievance means that employee can complaint to management. Every employees have right to pursue personal grievance. Before the personal grievance employee first tell to representative that there is done within 90 days and then them complaint. If they employee lost money and if there is some discrimination between the employees they can bring personal grievance. Unjustified dismissal means the employee believe that they have unjustifiably dismissed. They can use the personal grievance against the employer and representative. Constructive dismissal means if the employee who feel that they have been facing the employer to resign or leave the job they can use personal grievance. Some example of the constructive dismissal means employer will tell employees to leave the job or u will be terminated. Performance Management Performance Management Other than the above, employers can ride on the performance appraisal event to provide feedback to the employees regarding his or her past performance and to help them to improve their job performance. This exercise also provides opportunity for employees to express their feelings about the job and to increase interpersonal communication. From this it can stimulate interest in self-development for the purpose of greater personal development. Beside, performance appraisal will produce a databank of information can be used for financial and non-financial rewards. Performance management approaches are generally described in the context of Managing by Objective (MBO) framework. MBO programs is an knowledge that evaluation must be secured to act like objective setting, communicate expected result, establish time frame and how to accomplish objective (Nankervis, Compton McCarty, 1999, Pg. 399 400). Within the managing by objectives system the performance management process refers to the management of individuals, starting with the assignment of individual objectives through the final, formal assessment process. Employees today would like to climb the corporate hierarchy as quick they can. To stop employees from job-hopping, companies should provide views for individual and professional development. If people can achieve their development objectives with one employer over a long period of time, they will usually continue the same pace. Employees will certainly seek clearer fields if they distinguish the environment is restrictive. Especially when reviews are not fair, accurate and timely, they fail to compensate star workers, fail to provide support and guidance to average workers and fail to give proper feedback to whose work is imperfect.It is in no doubt that there is convincing plane logic for steps in a performance management system. And, the benefits and purposes cited for such a system are intuitively compelling; there are very few managers who would disagree with any of the functions or results apparently associated with performance management. Keep in mind that while most agree with the concepts, few actually implement them. In todays global economy, the advantage of growth from employees performance is cleared. It is referred as intangible performance. Stock returns are closely correlated with intangible performance. Take for example how Bill Gates built a multibillion-dollar software empire and how McDonald created its fast food kingdom. Many businesses are going through the same kind of internal dialog about their assets, particularly in the global economy, firms with relative little invested in factories and other tangible assets. To improve business performance, therefore, companies need tools that grow and manage their intangible assets. In this assignment we will discuss a few important issues when deciding and implementing an effective performance management system. As mentioned above, performance management is generally descr ibed within the context of MBO. As such the process shall be started with a thorough understanding of an organizations business strategy. Here we refer to a strategy that is not lets make money. Rather, its here how to make money.In the context of strategic corporate planning, Balance Scorecard framework is widely used for goals and objectives setting for the entire organization or department. These goals and objectives are made as team goals. The Balance Scorecard provides a framework to describe and communicate strategy in a consistent and insightful way (Kaplan Norton. 200, Pg. 10). This works best in departments or entire organization where the people are fairly independent and striving to achieve a singular purpose. A strategic scorecard is a process of establishing multi-faceted measures of an organization or unit they typically includes: (a) finance; (b) customer; (c) internal business process and (d) leaning and growth.Having, balance scorecard organizational strategic dire ction is communicated well to the employees who must implement it. Once strategy is clear the process then moves to indemnifying cause-and-effect relationship driving business success. Nankervis, Compton McCarty (1999, Pg 380) stress that performance review must never be taken isolation but, rather, tied directly to the organizations strategic plan and the strategies that make up that plan. Organizational success is base on the result of adding together all the individual outputs. Using a mathematic equation as an example, if person X and person Y and person Z do their jobs correctly, the organizations results are X + Y + Z. manage each individuals result, and organization will succeed. Key Factor in an Effective Performance Management System As mentioned in the introduction, performance appraisal is the process of formal process in assessing someones performance. Performance appraisal is the end of process that goes on all the times. It is a process that is based on good communication between managers and employees (subordinates). In this exercise, not only the manager and employees is the key to success, the human resource department also play an important role because it can create a situation that virtually determine the value from the performance appraisal process.Manager and supervisors traditionally have served as appraisers of their subordinates performance (Nankervis, Compton McCarty, 1999, Pg. 385). Appraisers do appraisal to improve performance, not to find a donkey to pin a tail on or blame. Because blaming process is pointless and doesnt help anyone. If there is to be a point to performance appraisal it should be getting manager and employee working together to have everyone get better. Formal appraisal is normally conducted every six months or one year, however, feedback is not just relevant to annual or semiannual appraisal. Feedback about performance needs to be immediate and continues since it is to influence future behavior. Appraisers should spend more time to prevent problems than evaluating at the end of performance cycle. When appraisers do good things during the performance evaluation period, the appraisal is easy to do and comfortable because there wont be any surprises.Many times, we found appraisers did all sorts of funny and dump things to destroy the process of performance appraisal that is important to everyone. But another important factor in the appraisal process is the employees they themselves herein referred as appraise. Appraisers take their cues from management and human resources. However, when appraise perceive the process in negative ways, they can create or damage even the best appraisal processes. Appraiser tend to take their jobs personally and making it m ore difficult to hear others comments about their works, particularly when they are critical. Even constructive criticism is often hard to hear. When appraise enter into the discussion with an attitude of defending then its almost impossible to create the dialog necessary for performance improvement. Appraisers are advised or should present their own opinions and perceptions in a calm, factual manner rather than a defensive, emotional way. Of course, if appraisers are inept in the appraisal process, it makes it very difficult to avoid this defensiveness. Similar to the appraisers, appraisees need to know how they are doing all year found, not just at appraisal time. Generally it is primarily appraisers responsibility to ensure that there are no surprises at appraisal time. Often, appraiser discusses both positives and negatives of appraiser performance throughout the performance period, but this is unfortunately not a universal practice. Its in the appraiser interests to open up dis cussion about performance during the period, even if the appraiser does not initiate it. The sooner appraisees know where they are at and what they need to change and keep doing, the sooner the problems can be fixed. In fact many problems can be prevented if they are caught early enough. Even if appraisers arent creating that communication, appraiser can and should. It is a shared responsibility. The success and failure of performance appraisal system doesnt just fall on appraisers and appraise only. Human resource department is one of the major contributors to the final results. F then, human resource department tends to focus on and stress the paperwork and forms. We can understand why human resource personnel want some sort of paper trail related to performance appraisal in concerning the formality and the possible legal implications. But when the emphasis on the forms and paperwork overshadows the real purpose of doing appraisal, the huge amounts of resources are wasted. When hu man resource department focus on getting the forms done, thats exactly what they get i.e. forms done.Documentation in performance appraisal is seen as the central of performance appraisal. The issue is that the one size fits all requirements doesnt really work. In many organizations, human resource department uses a standardization approach; this means one form use across the organization. A weakness of many performance programs is that manager and supervisors are not trained adequately for the appraisal task and provide little meaningful feedback to subordinates (Nankervis, Compton McCarty, 1999, Pg. 389). Training for not only the appraisers but also the appraisees in their role in the appraisal process is one the important tasks of human resource department. Both appraiser and appraiser need to hold the same understanding about why they are doing appraisal, how it will be done and what is expected. In this discussion, top management is being seen as on the key factors in perform ance appraisal system. Recognition and commitment from top management towards the performance appraisal system will eventually affect the entire implementation of such system. People who involve in the appraisal process will conduct appraisal so long as they have to do so to justify or withhold certain objectives. Management can influence personnel in a holistic manner to ensure the ultimate goal of performance management system i.e. for improving individuals, teams and organization as a sole base on measures that tie directly to the success drivers of the organization. Performance appraisal isnt about the forms although, often management, appraiser and human resource department treat it as such. The ultimate objective of performance appraisal s to allow employees and managers to improve continuously and to remove barriers to job success and not to get the organizational success as well. The major responsibilities for setting performance assessment tone and climate rest with apprais ers and the human resource department. However, even when managers and human resource department do their job well, workers who come at the process with unenthusiastic or suspicious approach are not likely to aim from the process or to do well over the long term. The constant key for successful performance management is active and self-confident sharing among the key personnel, but keeping a problem-solving mindset, and keeping focus on how things can be improve in the future. No matter how instigates it, performance appraisal is about positive open communication between appraises and appraisers. Implementation of Performance Management System: Problems and Recommendations: Performance appraisals are always sticky for everyone. While organizations make an effort to be as objective as possible, there are always concern about specific performance appraisals and their accuracy. Performance appraisal instruments are considered as test and must be validated against actual job-related requirements. Job requirements or standards should be based on job analysis or competency profiling and resulting job description and job specifications. When performance standards are properly established, they will translate job requirements into levels of acceptable or unacceptable employee performance (Nankervis, Compton McCarty, 1999, P. 390). It is a facto life that the easiest things to measure or evaluate are the least important things with respect to doing a job. Take for example; managers can simply define customer service as answering phone call within three rings or reply e-mails within 24 hours or some such thing. That is easy to measure if it is wanted. What is not easy to measure is the overall quality of service that will get and keep customers. By adding in the clause regarding legitimate customer complaints it becomes event serious. One-sided judgment must be trained and there is room for understanding, and the manager is required to evaluator whether a complaint is legitimate or not. So, the standard is no longer objective. Measuring overall customer service is hard, we could carry the above example to the point where standard resembles war peace, but the point here is that the more quantifiable a standard is, the less relevant it becomes. It is easy to measure a trivial but it is hard to measure what is important in an objective way. Many instruments have been developed to improve employees performance. Written procedures are a better contact between the employees and manager, incentives or punishment and so on. However, even well written standards have an appearance of objectivity but require subjective judgments. Expectation about work output in terms of quality, quantity, errors, waste, etc should be discussed as often as necessary until the employee is self-monitoring and self-correcting. When the subordinate is consulted in setting up standards of performance and he / she is given an opportunity to express his opinions during the post-appraisal interview will give him / her sense of participatio n and probably increase job satisfaction. Moreover, having helped to set the goals himself / herself, he / she will be less disposed to argue later about what is expected of him / her (Heyel, 1958, Pg. 33). Nankervis, Compton McCarty (999, Pg 391) suggested that jobs which involve tasks where qualitative measurement is difficult, this job it may well be that success must be measured in how the work is performed rather than by end numerical result. One cannot ignore in the appraisal system is the role of personal trait because it bear significant when performing current job and considering the potential of an individual for higher position in an organization. Any shortfall, training and development have to come in place to rescue and improve the situation for success. The performance management system conveys to people in an organization how work is to be performed and communicated, often unintentionally the values and organizational culture too. More specifically performance manage ment system can foster a lack of collective responsibility for achievement of organizational goals, encourage competition rather than cooperation and can impede the development of effective teamwork. It is not surprising that we eagerly embrace the idea that each person should be both responsible and accountable for this or her work. I am sure you agree. Performance management is designed to enhance this personal responsibility. It implies that you are not responsible for the work of others that is important to the organization. It focusing on individual responsibility reduces an employees responsibility to the organization and the activities that are not his or her job. To overcome this problem, management should create an environment in which all members of the organization are continuously buzzing about and striving to improve the organizations performance relative to its purpose. Promote team spirit, interest and induce feeling towards the responsibility for almost everything th at goes on. When employees want to be involved, they contribute ideas, they function in a team context because they see achievement of overall organizational objectives as more important than the achievement of their own objectives. Perhaps the mathematics equation illustrated earlier can be used as an example for explanation to all employees. Due to the limitation of, we shall look at the final problem for this assignment i.e. the relationship between performance and rewards system. Many organizations tie employee pay appraisal results, which puts employee and manager on opposite sides. Employees in such system tend to focus too much on the money component, although that focus is certainly understandable. It is also understandable when employees in such systems become hesitant to reveal shortcomings or mistakes. If employees main intention is to gain as much of pay raise out of the company, and the management tries to keep increasing as little as possible, it becomes completely imp ossible to focus on what eventually matters over the long term which is continuous performance improvement and success for the company overall. It may be very important, where possible, to tie remuneration and benefits to performance or at least to ensure that benefits package supports that organizational objectives (Lockett, 1992, Pg 199). Pay is important but it is on the only issue that related to the appraisal focus. Furthermore, pay is just one elements of reward. Promoting people on the basis of performance can divert the focus; however the factors appraised must be highly correlated to the requirements of the new job. Frequent reviews of the relationship between performance and reward system are important to retain high performance. How do we do that? We should start looking at how fairly are rewards distributed base on performance and does every employees understand this or in other words is how transparent is the system to all parties in an organization. Bibliography: Heyel, C., (1958), Appraisal Executive Perfomance, Amacom, New York Ivanchvich, J., (1998), Human Resource Management, 7th Edition, McGraw Hill, New Jersey. Kaplan, R. S. Norton, D. P., (2001), Harvard Business Scholl Publishing Corporation, Boston. Lockett, J., (1992), Effective Performance Management: A Strategic Guide to Getting the Best from People, Kongan Page Limited, London. Nankervis, A., Compton, R. McCarty, T., (1999), Strategic Human Resource Management, 3rd Edition, Nelson, South Melbourne. Schermerhorn, J. R., (1999), Management, 6th Edition, John Wiley Son Inc, New York. Sherman, A., Bohlander, G. Snell, S., (1998), Managing Human Resources, 11th Edition, South-Western College, Ohio. Thompson, A. Strickland III, A., (2001), Strategic Management Concept and Cases, 12th Edition. McGraw-Hill Irwin, New York.

Argumentative Essay on Cervical Cancer

Shelley Miller Dr. Ashli Dykes Composition 1 12 November 2012 Cervical Cancer Cervical cancer is a cancer that starts in the cervix, the lower part of the uterus, which opens at the top of the vagina. It occurs when abnormal cells on the cervix grow out of control. Cervical cancer can often be successfully treated when it is found early. It is usually fount at a very early stage through a pap-test. Cervical cancer is the third most common type of cancer in the world. Routine pap-smears, in the United States, have narrowed down the disease, unlike other countries.This disease starts in the cells on the surface of the cervix. Of the two types of cells, on the surface of the cervix, squamous and columnar, the majority of cervical cancers form on the squamous cells. It is a slow developing disease. It starts out as dysplasia, a pre-cancerous condition. Normally a pap-smear can detect the pre-cancerous condition. If left undetected, over years, a pre-cancerous condition can turn into cerv ical cancer. In most circumstances, women who have routine pap-smears normally do not get cervical cancer (PubMed Health).The most recent statistic numbers available are from the year 2008. There were 12,410 women in the United States diagnosed with cervical cancer. Out of all those women, 4,008 of them died from the disease. These incidents and death counts cover approximately 100% of the U. S. population in 2008. The famous Greek physician, Hippocrates, was the first to write about cervical cancer in 400BCE; although, he could identify the disease, he declared it incurable. In the following twenty-five centuries, many women died from this disease. Dr. Hinselmann invented the colposcope in 1925.The colposcope allowed doctors to examine the cervix more closely, which allowed them to check for abnormalities. The closer examinations meant that some cancers were found in time for surgery to be successful. The pap-smear was named after Georgios Papanikolaou, who in 1928, found that he c ould identify abnormal cells taken from the surface of the cervix. Since its invention in 1943, this procedure has saved many lives all around the world. It’s estimated that if a woman’s cervical cancer is diagnosed by a Pap smear, rather than before symptoms appear, she has a 92% chance of a full recovery.If she waits for signs of disease before going to the doctor, her chance of survival drops to 66%. More than 70% of women who die from cervical cancer have not had a Pap smear within the last five years. It’s recommended that all women between the ages of 21 and 60 have a smear test every three to five years, although if a woman has never been sexually active, the test is not necessary. Epidemiologists, in the early twentieth century, noticed that cervical cancer shared many characteristics of a STD (sexually transmitted disease) (Yukozimo).Although there are normally no signs of early stages in cervical cancer, the symptoms that may occur are similar to those of a STD. Symptoms of cervical cancer are abnormal vaginal bleeding, continuous vaginal discharge, and/or abnormal periods. Abnormal vaginal bleeding can or may include between periods, after intercourse, or after menopause. Periods may be abnormal if they become heavier or last longer than usual. Vaginal discharge may be â€Å"pale, watery, pink, brown, bloody, or foul-smelling. † Another easy to recognize symptom, of early stages, is pain during intercourse.Patients with cervical cancer generally start having problems when it advances and spreads to nearby tissue. It may spread to the bladder, lungs, intestines, and liver. If the cancer spreads, the symptoms become more noticeable and serious. The symptoms of advanced cervical cancer includes back pain, bone pain or fractures, fatigue, difficulty urinating, pain when urinating or blood in urine, as well as, leaking of urine or feces from vagina, leg pain, loss of weight and appetite, pelvic pain, single swollen leg, and/or weight loss (PubMed Health).Other symptoms of advanced cervical cancer are diarrhea, or pain or bleeding from the rectum upon defecation, fatigue, and general feeling of illness, and a swollen abdomen, nausea, vomiting, and constipation. (WebM. D. ) Most cervical cancer cases start out as HPV (Human papilloma virus), which is a common virus spread through sexual intercourse. There are many types of HPV; however, not all types lead to cervical cancer. Increased risks for cervical cancer can be determined by a woman’s sexual habits.Having sex at a young age, multiple sex partners, or having multiple partners who participate in high risk sexual activities are all examples of risky sexual habits. Other risk factors include poor economic statue, not getting the HPV vaccine, weakened immune system, and being born to a mother who took the DES drug (diethylstilbestrol, which prevented miscarriages), while pregnant. There are many different types of treatment for cervical cancer but it depends on several things like what stage the cancer is in, size and/or shape of the tumor, the age of a woman, her general health, and her desire of having more children later on.Destroying or removing the pancreas or cancerous tissue can cure cervical cancer in its early stages. There are other types of treatments, involving surgery, which can be done without destroying the uterus or damaging the cervix so that, in the future, a woman can have other children. LEEP (loop electrosurgical excision procedure), cryotherapy, or laser therapy, are the types of surgeries that can be done; however, they are only effective if the cancer is caught at an early stage. Leep uses electricity to remove abnormal tissue, cryotherapy freezes abnormal cells, and laser therapy uses light to burn abnormal cells.A hysterectomy is a more intense surgery used to cure cervical cancer. It works by removing the uterus but not the ovaries. This surgery is usually performed in result of multiple failed LEEP procedures. There are more advanced treatments for those whose cervical cancer is later detected. These procedures are radical hysterectomy and pelvic exenteration. A radical hysterectomy consists of removing the uterus as well as the surrounding tissues, which include the lymph nodes and the upper part of the vagina.The pelvic exenteration is an extreme type of surgery in which all of the organs of the pelvis, including the bladder and rectum, are removed. In some cases when the cancer has spread beyond the pelvis or has returned, forms of radiation therapy are used. There are two forms of radiation therapy used: internal and external. Internal radiation therapy uses a device filled with radioactive material, which is placed inside the woman's vagina next to the cervical cancer. The device is removed when she goes home. External radiation therapy beams radiation from a large machine onto the body where the cancer is located.It is similar to an x-ray (PubMed Health) In conclusion, cervical cancer is a serious condition in which the medical field has been experimenting with and developing cures for throughout the years. The advances made in this study, since it was discovered in 1943, are remarkable. Due to the developments of tests and treatments for this disease, the amount of women who die from it, has decreased greatly. Hopefully in the years to come, researchers will find a way to make cervical cancer extinct. Work Cited â€Å"Cervical Cancer. † PubMed Health. A. D. A. M. , Inc. 2012.Web. 10 November 2012. www. ncbi. nlm. nih. gov/pubmedhealth/PMH0001895/ â€Å"Cervical Cancer Health Center. † New York, NY. WebMD. WebMD, LLC. 2005-2012. Web. 07 November 2012. www. webmd. com/cancer/cervical-cancer/default. htm Division of Cancer Prevention and Control, National Center for Chronic Disease Prevention and Health Promotion. â€Å"Cervical Cancer Statistics. † CDC. Web. 08 November 2012. www. cdc. gov/cancer/cervical/statistics â€Å"Who Discovered Cervical Cancer? † Yukozimo. Web. 12 November 2012. www. discovery. yukozimo. com/who-discovered-cervical-cancer/

Financial Statements Paper Essay

The statement usually includes beginning balance, net income for the current cycle, dividends disclosed in the current period and ending balance. Balance sheets detail assets and claims to assets at a distinct point in time. Claims of creditors and claims of owners are examples of claims to assets. This particular statement provides a clear outline of the financial standing of the company as a whole. The direct function of a statement of cash flow is to present financial information such as cash receipts and payments during a set point in time. This assists investors and creditors to analyze a company’s financial position.. These statements address a company’s financing, investment and operational activities. Financial statements are useful to managers as these statements are utilized to measure the performance of the organization. Sales and expenses are compared to the income statements from previous periods by management to pinpoint possible problematic areas. Major variations adjure management to thoroughly understand what the causes of those changes are. Variations in liabilities and assets are examined on the balance sheets from one cycle to the next. Any large variations need to be identified, explained and reasons established to whether the variations benefited the company, or caused a loss as consequences of problems. From this point management can make adjustments to correct any problems, or future planning, so these losses or problems do not repeat again. The benefits can be capitalized upon as well. Financial statements are useful to employees for the reason of collective bargaining, discussing compensation, and ranking. Employees also use this information as a means to determine the ability of the company to provide retirement benefits and opportunities for advancement. Financial Statements are useful to investors as they hold an interest in the profits of the company. The investors are looking for a return in the money they have invested, usually in the form of stocks, as they seek increases in stock value and profitability. Lending decisions to be made by creditors are based upon the financial statements. The creditors want to ensure that the companies they are lending the funds to have the ability to manage its finances so they are not at risk of not being able to pay back its debts. References: Kimmel, P. D. (2009). Financial Accounting: Tools for Business Decision Making (5th ed. ). Retrieved from The University of Phoenix eBook Collection database..

Strategy Plan for Hmv Group. - 1212 Words

TASK 1. a) Explain and analyse external factors affecting HMV. Executive summary HMV Groups markets had experienced rapid change over recent years and have become more competitive and with a diminishing amount of in store sales as consumers choose to use the internet to fulfil their needs. These trends are heavily influenced by celebrities and other social icons as well as advertising and publicity. The main technological development is that of the internet. It has also given rise to competition in the form of piracy which is a growing social/ political issue. Piracy has had a large affect on sales and demand within the industry and any changes in law/ legislation or enforcement of piracy will have a large effect on the HMV group. It†¦show more content†¦The main social issue that affects that can influence sales are lifestyle or consumer trends. The products sold by the HMV Group and its competitors are not necessity goods and have very wide ranges of appeal. Consumer trends can change very rapidly and can be very troublesome or profitable for retailers in the industry as it can either leave them with to much or too little stock to meet demand. Political Environmental issues government legislation international law universal rights taxation regulatory bodies government term and change trading policies funding, grants and initiatives pressure groups . Economic Economic trends taxation, seasonality markets and trade customer forces interest and exchange rates, competitors, suppliers, employment rates policies . Society Lifestyle trends demographic trends skills availability consumer attitudes and opinions media laws trends major events ethnic and religious factors gender issues business ethics environmental concerns . Technological Technological development research and funding information and communications innovation potential intellectual property issues new production processes transport technology . c) SWOT analysis of HMV The most common tool used to access the above is a SWOT analysis. SWOT is an acronym used to describe the particular Strengths, Weaknesses, Opportunities, and Threats that are strategic factors for a specific company. A SWOT analysis should not only result inShow MoreRelatedMarketing Management Question on Hmv- London School of Commerce1670 Words   |  7 Pagesassessment: * Each group must submit a hard copy of the report * Each member should speak for 4 minutes --------------------------------------------------------------------------------------------------------------------- Description of Assessment Requirements You have joined HMV’s marketing department in the UK and have been asked to recommend a marketing plan for HMV to ensure continued growth in the future. You should think about new ways in which HMV can distribute  music  andRead MoreSegmentation And Target Market Analysis1485 Words   |  6 PagesSegmentation and Target Market Paper The fundamental component of Market segmentation is a market-based strategy. Market segmentation strategies are generally used to identify and further define the target customers, and provide supporting data for marketing plan elements such as positioning to achieve certain marketing plan objectives. Businesses may grow product differentiation strategies, or an indistinguishable approach, concerning specific products or product lines subjectable to the specificRead MoreStrategy Management Hmv4090 Words   |  17 PagesExecutive Summary An Executive Report advising HMV’s Management on competitive strategies. In this analysis we will take a look at the biggest entertainment media seller with physical stores in the UK. The contents of the report are an analysis of the company’s current competitiveness and recommendations on the future strategic direction of the company. Introduction With the rise of digital media and broadband capabilities, many brick and mortar sellers are faced with challenges toRead MoreHmv Group Plc’s Environmental and Strategic Position.3452 Words   |  14 PagesCity Analyst outlining the analysis and evaluation of HMV Group plc’s environmental and strategic position, giving suggested new organisational strategies and plans. Environmental and Organisational Audit Environmental and organisational audits are used to discover a company’s position in their market and environment, and the company’s physical position. Two possible environmental audit techniques that can be done on a company like HMV Group plc are Porter’s 5 Forces and PESTEL analysis. Porter’sRead MoreManaging Strategic Change at the Hmv Group8681 Words   |  35 PagesStrategic Change At The HMV Group | 1. Introduction HMV Group announced a three year strategic and operational review in March 2007. The primary purpose of this dissertation is to analyse the methods used to manage this strategic change and to discuss alternatives. The secondary focus is to assess the decision to change.   At a time of change, much focus is placed upon developing strategy and not enough on the implementation and management side. It is possible that a ‘perfect strategy’ for a situationRead MoreHmv Market Environment2711 Words   |  11 Pagesmarketing audit on HMV which is a UK based international entertainment retail chain. It is listed on the stock exchange and earns millions from selling entertainment to countries around the world. THE MARKETING ENVIRONMENT This consists of both Macro and Micro forces which are not fully controllable by the business. These external influences can be kept under certain limits of control by identifying and monitoring these forces that are relevant to the business. This is how HMV can keep control. Read MoreHmv Waterstones Analysis3325 Words   |  14 PagesFor this assignment I have been tasked with conducting a strategic analysis of the HMV group. This analysis shall be in the form of a report and will include an environmental, internal and external audit of the HMV group. I will also be basing my recommendations on the future direction that HMV group should move in for the next 3 years from the audits and other research data. Introduction to the HMV group HMV Group is one of the world s leading retailers of music and DVD and the leading retailerRead MoreAnalysis of HMV3085 Words   |  13 PagesSEGMENTATION AND 7PS OF HMV. INTRODUCTION: The largest retail entertainment chain in Britain is HMV of its kind. What that mean is HMV is the leader in retail entertainment in Britain with over 150 retail stores within the country and more than 600 stores worldwide. Employing more than 13000 people it makes nearly 2 billion of revenue each year. HMV mainly specialises on music CDs and DVDs, books, games, gadgets, video games, movies, technology, fashion, magazine etc. Presently HMV is one of the largestRead MoreEthical Standards : A Framework For Auditor Independence1978 Words   |  8 Pagesstatement. The objective of ISA 300 is to establish the overall audit strategy and to develop an audit plan to reduce audit risk to an acceptably low level and to ensure the whole auditing process works effectively and efficiently. To make sure the plan performed in an effective manner, the auditor should develop general strategy that sets the scope, timing and direction of the audit, and that guides the development of the audit plan and describe the nature, timing and extent of planned risk assessmentRead MoreIndustry : Exclusive Artistic Products Industry1077 Words   |  5 Pagesforces have more positive impact on this industry, Take full advantage of environmental law and political stability to boost business. Organizations need to be able to respond to current and anticipated future legislation changes to adjust its marketing plan. Such as which country to register the business. E Economic Foreign trade policies and exchange rates and new business tax regulations in U.S. are fluctuating. Canada is relatively stable. The economies of the countries are on the rise Be mindful